Incidental Mutation 'R1341:Uhrf1bp1'
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 039406-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1341 (G1)
Quality Score208
Status Validated
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 27877419 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably benign
Transcript: ENSMUST00000114849
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512

Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130810
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v0e2 A G 6: 48,540,111 Y75C probably benign Het
C87977 T C 4: 144,207,559 D326G probably damaging Het
Cacna1g A G 11: 94,433,756 L1190P probably damaging Het
Ccdc190 A G 1: 169,930,017 D15G probably damaging Het
Cep126 G T 9: 8,099,776 P919Q possibly damaging Het
Chchd6 A G 6: 89,384,641 V260A probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cramp1l T C 17: 24,977,540 K867E probably damaging Het
Dnah6 A T 6: 73,191,619 N440K probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm17421 A T 12: 113,369,714 noncoding transcript Het
Gm4788 T A 1: 139,732,393 T665S probably damaging Het
Hdac3 A G 18: 37,954,713 V36A probably damaging Het
Hist1h2bl T C 13: 21,716,110 K12E probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Itga10 G A 3: 96,652,495 E489K probably damaging Het
Mgat5b A C 11: 116,978,397 I589L probably benign Het
Mindy4 A G 6: 55,255,616 N348S probably benign Het
Mmp15 A G 8: 95,372,303 D586G probably benign Het
Mmp9 A G 2: 164,949,327 D139G probably damaging Het
Morc2a C A 11: 3,680,216 L471I possibly damaging Het
Mycbp2 T A 14: 103,298,867 probably benign Het
Mylip T A 13: 45,405,936 S105T probably damaging Het
Nat8f4 A T 6: 85,901,424 L39Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Obscn T C 11: 59,029,372 probably benign Het
Olfr1086 T C 2: 86,677,163 M57V possibly damaging Het
Olfr1337 T C 4: 118,782,382 T68A probably benign Het
Olfr279 G A 15: 98,498,254 V261M possibly damaging Het
Olfr633 T A 7: 103,947,382 V272D possibly damaging Het
Olfr825 G T 10: 130,163,316 D3E probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rab11fip1 G T 8: 27,143,360 A1106E probably damaging Het
Rfc1 A G 5: 65,291,194 S363P probably damaging Het
Skint10 A G 4: 112,765,031 probably benign Het
Spen T C 4: 141,469,400 N3595D possibly damaging Het
Swsap1 A G 9: 21,957,154 K241E probably benign Het
Tab1 A G 15: 80,160,114 T448A possibly damaging Het
Tktl1 G T X: 74,197,683 G302V probably damaging Het
Usp25 A G 16: 77,115,443 T1017A probably benign Het
Vmn2r78 T A 7: 86,922,269 M429K possibly damaging Het
Wdr49 A T 3: 75,429,333 F356I probably damaging Het
Wnt1 T C 15: 98,791,883 F184L probably damaging Het
Yy1 T C 12: 108,793,519 I36T unknown Het
Zbtb39 A G 10: 127,743,500 I648V possibly damaging Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4431:Uhrf1bp1 UTSW 17 27885931 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 splice site probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 splice site probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
R8338:Uhrf1bp1 UTSW 17 27876695 missense probably damaging 1.00
RF005:Uhrf1bp1 UTSW 17 27885531 missense probably damaging 1.00
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Z1176:Uhrf1bp1 UTSW 17 27876676 missense probably damaging 1.00
Z1176:Uhrf1bp1 UTSW 17 27886306 missense probably damaging 1.00
Z1177:Uhrf1bp1 UTSW 17 27884966 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttaagccaggaaaattgagacac -3'
Posted On2014-02-11