Incidental Mutation 'R1353:Crb2'
ID157073
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1353 (G1)
Quality Score155
Status Not validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37787281 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 262 (C262R)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect probably damaging
Transcript: ENSMUST00000050372
AA Change: C262R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: C262R

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147600
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGCACACAAGAAGGGTGTCTG -3'
(R):5'- GCAGTAGCACTGGAAACCATTGGG -3'

Sequencing Primer
(F):5'- CACAAGAAGGGTGTCTGAATGTTAG -3'
(R):5'- ATAAATAGCTCCTCTGTGACGGC -3'
Posted On2014-02-11