Incidental Mutation 'R1353:Zgrf1'
ID157081
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 039418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1353 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127611803 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1550 (T1550I)
Ref Sequence ENSEMBL: ENSMUSP00000143761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably damaging
Transcript: ENSMUST00000043108
AA Change: T1550I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: T1550I

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196141
AA Change: T1550I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: T1550I

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196341
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Capn9 A C 8: 124,605,566 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGCATACAGCAGCTTTAGATGTGG -3'
(R):5'- ACACTGCCCAGTGGAGTAGAAACC -3'

Sequencing Primer
(F):5'- TGTCTTCTGACTTAGGCTTCAAG -3'
(R):5'- GTCCAATGGCTAAACTATGAGC -3'
Posted On2014-02-11