Incidental Mutation 'R0002:Sbk3'
ID157134
Institutional Source Beutler Lab
Gene Symbol Sbk3
Ensembl Gene ENSMUSG00000085272
Gene NameSH3 domain binding kinase family, member 3
SynonymsLOC381835, Gm1078
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0002 (G1)
Quality Score51
Status Validated
Chromosome7
Chromosomal Location4965260-4971168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4970631 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000120654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133272] [ENSMUST00000144863]
Predicted Effect probably damaging
Transcript: ENSMUST00000133272
AA Change: D17G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120654
Gene: ENSMUSG00000085272
AA Change: D17G

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 43 268 1.8e-17 PFAM
Pfam:Pkinase 43 304 1.7e-30 PFAM
Pfam:Kinase-like 130 262 1.6e-8 PFAM
low complexity region 309 321 N/A INTRINSIC
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144863
SMART Domains Protein: ENSMUSP00000122507
Gene: ENSMUSG00000085272

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 248 3.1e-17 PFAM
Pfam:Pkinase 24 284 5.6e-32 PFAM
Pfam:Kinase-like 111 237 2.5e-7 PFAM
low complexity region 290 302 N/A INTRINSIC
low complexity region 309 328 N/A INTRINSIC
Meta Mutation Damage Score 0.2110 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Sbk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0344:Sbk3 UTSW 7 4967405 missense possibly damaging 0.53
R1396:Sbk3 UTSW 7 4967453 missense possibly damaging 0.86
R2115:Sbk3 UTSW 7 4967416 missense possibly damaging 0.86
R4073:Sbk3 UTSW 7 4970502 missense probably damaging 1.00
R4298:Sbk3 UTSW 7 4969980 missense probably benign 0.05
R5347:Sbk3 UTSW 7 4967423 missense probably benign 0.18
R5819:Sbk3 UTSW 7 4969997 missense probably benign 0.38
R6535:Sbk3 UTSW 7 4969841 missense possibly damaging 0.78
R6957:Sbk3 UTSW 7 4967523 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAGAGAATTTGAAGTCCACCCC -3'
(R):5'- ATATCTGGCTGCCTCCCTCAAGTG -3'

Sequencing Primer
(F):5'- ACCCCTTGGTGGCTGAAC -3'
(R):5'- GACCCCTAATTCTGCTAGGAC -3'
Posted On2014-02-14