Incidental Mutation 'R0002:A630095E13Rik'
ID157137
Institutional Source Beutler Lab
Gene Symbol A630095E13Rik
Ensembl Gene ENSMUSG00000070313
Gene NameRIKEN cDNA A630095E13 gene
SynonymsLOC235973, Sslp-1
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0002 (G1)
Quality Score25
Status Validated
Chromosome9
Chromosomal Location36635754-36643376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36637359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 59 (D59E)
Ref Sequence ENSEMBL: ENSMUSP00000139086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093868] [ENSMUST00000184611]
Predicted Effect probably damaging
Transcript: ENSMUST00000093868
AA Change: D59E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091391
Gene: ENSMUSG00000070313
AA Change: D59E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184611
AA Change: D59E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139086
Gene: ENSMUSG00000070313
AA Change: D59E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216487
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in A630095E13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:A630095E13Rik APN 9 36637850 missense probably benign 0.07
R0002:A630095E13Rik UTSW 9 36637359 missense probably damaging 0.98
R0511:A630095E13Rik UTSW 9 36638577 utr 5 prime probably null
R0684:A630095E13Rik UTSW 9 36637880 missense probably benign 0.00
R5011:A630095E13Rik UTSW 9 36637824 missense probably benign 0.03
R5013:A630095E13Rik UTSW 9 36637824 missense probably benign 0.03
R7721:A630095E13Rik UTSW 9 36637863 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGCAGTGGTGGACATTGTAGTCTCA -3'
(R):5'- ACAGCAGAAACCTCCTGTGAAGCTA -3'

Sequencing Primer
(F):5'- AGTACAAGGAAGGGATAAGGACTTAC -3'
(R):5'- GGGCCTTCTCAGTGAATATAATCAG -3'
Posted On2014-02-14