Incidental Mutation 'R0002:Sult3a2'
ID157139
Institutional Source Beutler Lab
Gene Symbol Sult3a2
Ensembl Gene ENSMUSG00000090298
Gene Namesulfotransferase family 3A, member 2
SynonymsGm4794
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0002 (G1)
Quality Score38
Status Validated
Chromosome10
Chromosomal Location33766424-33786704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33779807 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 59 (I59V)
Ref Sequence ENSEMBL: ENSMUSP00000152718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165904] [ENSMUST00000223295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165904
AA Change: I59V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127159
Gene: ENSMUSG00000090298
AA Change: I59V

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 36 283 8.9e-80 PFAM
Pfam:Sulfotransfer_3 37 207 6.8e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223295
AA Change: I59V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Sult3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Sult3a2 APN 10 33766439 missense probably benign 0.01
IGL03106:Sult3a2 APN 10 33779773 missense probably benign 0.25
H8441:Sult3a2 UTSW 10 33766478 missense probably benign 0.00
R0602:Sult3a2 UTSW 10 33782048 missense probably benign 0.04
R1170:Sult3a2 UTSW 10 33777192 missense possibly damaging 0.87
R1510:Sult3a2 UTSW 10 33782030 missense probably benign 0.03
R1572:Sult3a2 UTSW 10 33781977 missense probably damaging 1.00
R1725:Sult3a2 UTSW 10 33779709 missense probably benign 0.00
R4601:Sult3a2 UTSW 10 33782087 missense probably benign 0.00
R5570:Sult3a2 UTSW 10 33778272 missense probably damaging 1.00
R6529:Sult3a2 UTSW 10 33779737 missense probably damaging 1.00
R7996:Sult3a2 UTSW 10 33768258 missense probably damaging 1.00
V1024:Sult3a2 UTSW 10 33766478 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCAAGTGGCTAAGTTCTGTGAC -3'
(R):5'- GGCATGATCTGATCTGATCACGCTC -3'

Sequencing Primer
(F):5'- CTAAGTTCTGTGACATACTTTGGC -3'
(R):5'- GATCACGCTCTATTCATGTGTAG -3'
Posted On2014-02-14