Incidental Mutation 'R0002:Ccdc125'
ID157141
Institutional Source Beutler Lab
Gene Symbol Ccdc125
Ensembl Gene ENSMUSG00000048924
Gene Namecoiled-coil domain containing 125
Synonyms5830436D01Rik
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0002 (G1)
Quality Score45
Status Validated
Chromosome13
Chromosomal Location100669717-100697240 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 100693606 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 295 (Q295*)
Ref Sequence ENSEMBL: ENSMUSP00000130107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057325] [ENSMUST00000170347]
Predicted Effect probably null
Transcript: ENSMUST00000057325
AA Change: Q321*
SMART Domains Protein: ENSMUSP00000058484
Gene: ENSMUSG00000048924
AA Change: Q321*

DomainStartEndE-ValueType
coiled coil region 101 193 N/A INTRINSIC
coiled coil region 286 308 N/A INTRINSIC
Blast:ETS 362 447 1e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000170347
AA Change: Q295*
SMART Domains Protein: ENSMUSP00000130107
Gene: ENSMUSG00000048924
AA Change: Q295*

DomainStartEndE-ValueType
coiled coil region 101 151 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Ccdc125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Ccdc125 APN 13 100687102 splice site probably benign
IGL02867:Ccdc125 APN 13 100684282 splice site probably benign
R0014:Ccdc125 UTSW 13 100684338 missense possibly damaging 0.82
R0717:Ccdc125 UTSW 13 100690358 missense probably damaging 0.99
R1661:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R1665:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R3118:Ccdc125 UTSW 13 100690319 missense possibly damaging 0.46
R3751:Ccdc125 UTSW 13 100677951 missense possibly damaging 0.90
R4415:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R4838:Ccdc125 UTSW 13 100677945 missense possibly damaging 0.52
R5734:Ccdc125 UTSW 13 100687114 missense possibly damaging 0.66
R5812:Ccdc125 UTSW 13 100684304 missense probably damaging 1.00
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6419:Ccdc125 UTSW 13 100690326 missense probably damaging 1.00
R6456:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R6733:Ccdc125 UTSW 13 100694487 missense probably benign 0.04
R7183:Ccdc125 UTSW 13 100690358 missense possibly damaging 0.90
R7354:Ccdc125 UTSW 13 100677874 intron probably null
R7644:Ccdc125 UTSW 13 100678376 intron probably null
R7910:Ccdc125 UTSW 13 100682819 missense possibly damaging 0.83
R7948:Ccdc125 UTSW 13 100696402 missense probably benign 0.00
X0027:Ccdc125 UTSW 13 100681845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGCCGGGTAATGAGTTTCAAG -3'
(R):5'- CACACACCTACCGAGCTATGTTCAG -3'

Sequencing Primer
(F):5'- CAGGTGCTGATTTAAGCAGAC -3'
(R):5'- GAGTTAACAACTAGATGCTCCACTG -3'
Posted On2014-02-14