Incidental Mutation 'R0002:Tapbp'
ID157142
Institutional Source Beutler Lab
Gene Symbol Tapbp
Ensembl Gene ENSMUSG00000024308
Gene NameTAP binding protein
SynonymsTPN, tapasin, D17Wsu91e
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0002 (G1)
Quality Score78
Status Validated
Chromosome17
Chromosomal Location33915899-33929288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33925632 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 234 (A234V)
Ref Sequence ENSEMBL: ENSMUSP00000025161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
Predicted Effect probably damaging
Transcript: ENSMUST00000025161
AA Change: A234V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: A234V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172489
SMART Domains Protein: ENSMUSP00000133332
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
IG 18 142 3.45e0 SMART
SCOP:d2fbjh2 143 189 2e-3 SMART
Blast:IG_like 152 206 6e-31 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Meta Mutation Damage Score 0.2812 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Tapbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tapbp APN 17 33919892 missense probably benign
IGL00229:Tapbp APN 17 33925704 missense probably damaging 1.00
R0416:Tapbp UTSW 17 33925418 missense probably damaging 0.99
R0800:Tapbp UTSW 17 33926253 missense probably benign 0.39
R0839:Tapbp UTSW 17 33925743 missense probably benign 0.00
R1584:Tapbp UTSW 17 33919940 unclassified probably null
R1617:Tapbp UTSW 17 33920431 missense probably benign 0.06
R2214:Tapbp UTSW 17 33920326 missense possibly damaging 0.90
R3941:Tapbp UTSW 17 33920483 missense possibly damaging 0.91
R4570:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4571:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4935:Tapbp UTSW 17 33925622 missense probably benign 0.02
R6195:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6233:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6468:Tapbp UTSW 17 33926098 missense probably damaging 1.00
R6736:Tapbp UTSW 17 33919957 missense possibly damaging 0.85
R7139:Tapbp UTSW 17 33920048 missense possibly damaging 0.46
R7146:Tapbp UTSW 17 33925487 missense possibly damaging 0.93
R7233:Tapbp UTSW 17 33919969 missense probably damaging 0.99
R7448:Tapbp UTSW 17 33920417 missense possibly damaging 0.70
R7630:Tapbp UTSW 17 33920344 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGCACGACGAAATTTTATTGTGCCC -3'
(R):5'- GGACTCCCAACTGTCTTCAGTATCACC -3'

Sequencing Primer
(F):5'- CAGTGTGTGTGTTCAACACC -3'
(R):5'- GGTGTTCCCCGACTCACTG -3'
Posted On2014-02-14