Incidental Mutation 'R0002:Spink12'
ID157143
Institutional Source Beutler Lab
Gene Symbol Spink12
Ensembl Gene ENSMUSG00000061144
Gene Nameserine peptidase inhibitor, Kazal type 12
Synonyms9230117E20Rik
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0002 (G1)
Quality Score34
Status Validated
Chromosome18
Chromosomal Location44104407-44108543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44107696 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 50 (C50R)
Ref Sequence ENSEMBL: ENSMUSP00000080025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081271]
Predicted Effect probably damaging
Transcript: ENSMUST00000081271
AA Change: C50R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080025
Gene: ENSMUSG00000061144
AA Change: C50R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
KAZAL 49 105 4.52e-12 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Spink12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Spink12 APN 18 44107805 missense probably damaging 1.00
IGL00731:Spink12 APN 18 44108110 utr 3 prime probably benign
IGL01694:Spink12 APN 18 44107760 missense probably damaging 1.00
IGL02379:Spink12 APN 18 44106508 splice site probably benign
IGL02702:Spink12 APN 18 44104769 missense probably benign 0.00
R0001:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0043:Spink12 UTSW 18 44107696 missense probably damaging 1.00
R0565:Spink12 UTSW 18 44104688 nonsense probably null
R0639:Spink12 UTSW 18 44107764 nonsense probably null
R1636:Spink12 UTSW 18 44107728 missense probably benign 0.10
R4073:Spink12 UTSW 18 44104664 missense possibly damaging 0.53
R5398:Spink12 UTSW 18 44107727 missense possibly damaging 0.46
R7620:Spink12 UTSW 18 44104617 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGAGAGCCGTGTCACGTTTG -3'
(R):5'- TCATGGACACCTACTCCACTGGAC -3'

Sequencing Primer
(F):5'- TGCAGCAGAACATACTGCTATAAG -3'
(R):5'- GGACCCAACTAAGAACATCTTGC -3'
Posted On2014-02-14