Incidental Mutation 'R0002:Catsper1'
ID157144
Institutional Source Beutler Lab
Gene Symbol Catsper1
Ensembl Gene ENSMUSG00000038498
Gene Namecation channel, sperm associated 1
SynonymsKSper
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0002 (G1)
Quality Score25
Status Validated
Chromosome19
Chromosomal Location5335741-5344153 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 5341523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025764] [ENSMUST00000043380]
Predicted Effect probably benign
Transcript: ENSMUST00000025764
SMART Domains Protein: ENSMUSP00000025764
Gene: ENSMUSG00000024846

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 33 147 2.36e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043380
SMART Domains Protein: ENSMUSP00000045430
Gene: ENSMUSG00000038498

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
low complexity region 308 321 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Pfam:Ion_trans 350 584 1.7e-34 PFAM
Pfam:PKD_channel 439 583 6.5e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit sperm with markedly decreased motility that are unable to fertilize ova and lack a calcium ion influx response to cyclic-AMP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Nuak1 A T 10: 84,375,367 W286R probably damaging Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Catsper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Catsper1 APN 19 5337772 missense probably damaging 1.00
IGL01361:Catsper1 APN 19 5339479 missense probably damaging 1.00
IGL02413:Catsper1 APN 19 5336236 missense possibly damaging 0.46
IGL02560:Catsper1 APN 19 5336188 missense possibly damaging 0.93
IGL03335:Catsper1 APN 19 5336311 missense probably damaging 0.97
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0324:Catsper1 UTSW 19 5336545 missense probably damaging 0.99
R1782:Catsper1 UTSW 19 5335909 missense probably benign 0.01
R2301:Catsper1 UTSW 19 5340398 missense probably benign 0.41
R3864:Catsper1 UTSW 19 5336176 missense possibly damaging 0.93
R4808:Catsper1 UTSW 19 5344136 missense possibly damaging 0.76
R4941:Catsper1 UTSW 19 5341438 missense possibly damaging 0.90
R4983:Catsper1 UTSW 19 5335963 missense probably benign 0.26
R5072:Catsper1 UTSW 19 5340046 unclassified probably null
R5077:Catsper1 UTSW 19 5335970 missense probably damaging 0.99
R5629:Catsper1 UTSW 19 5336137 missense probably benign 0.00
R6402:Catsper1 UTSW 19 5339496 missense probably damaging 1.00
R6875:Catsper1 UTSW 19 5343963 missense probably damaging 0.99
R7368:Catsper1 UTSW 19 5336663 missense unknown
R7510:Catsper1 UTSW 19 5339550 missense probably benign 0.26
Z1177:Catsper1 UTSW 19 5343883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTTGAATGCAGTCATTTGCCG -3'
(R):5'- AACATTTCTCTTTGGGTCCCTGGAAC -3'

Sequencing Primer
(F):5'- AGTCATTTGCCGGGTCAC -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2014-02-14