Incidental Mutation 'R0420:Prex1'
ID157149
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R0420 (G1)
Quality Score41
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166589571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 757 (D757V)
Ref Sequence ENSEMBL: ENSMUSP00000037180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
Predicted Effect probably benign
Transcript: ENSMUST00000036719
AA Change: D757V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: D757V

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
AA Change: D587V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: D587V

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Meta Mutation Damage Score 0.1415 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
R7721:Prex1 UTSW 2 166577890 nonsense probably null
R7763:Prex1 UTSW 2 166713709 missense unknown
R7809:Prex1 UTSW 2 166573244 missense possibly damaging 0.91
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTTGCTGAAGTCACAACACTCC -3'
(R):5'- CGTGCTAGGCAGCTATATTGTGTCC -3'

Sequencing Primer
(F):5'- ACTCCCGTTTGTAAAAGGGC -3'
(R):5'- TCTGAGATACCACATTGGGC -3'
Posted On2014-02-17