Incidental Mutation 'R1324:Lmnb2'
ID 157162
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
MMRRC Submission 039390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1324 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80904171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 330 (I330V)
Ref Sequence ENSEMBL: ENSMUSP00000100969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219817] [ENSMUST00000219896]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057623
AA Change: I471V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: I471V

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105332
AA Change: I330V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: I330V

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105333
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179022
AA Change: I452V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: I452V

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218149
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 T A 11: 61,915,021 probably null Het
Col11a1 A G 3: 114,030,916 R6G unknown Het
Enam A T 5: 88,494,068 Y172F possibly damaging Het
Fam109b A G 15: 82,343,498 T73A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kif21a A T 15: 90,948,322 probably null Het
Myom1 T A 17: 71,052,719 I462N probably damaging Het
Negr1 C T 3: 157,069,223 A192V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrxn3 T C 12: 89,254,696 I42T possibly damaging Het
Rnf141 G A 7: 110,816,843 R184* probably null Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Thoc6 G T 17: 23,677,463 probably null Het
Tmem39a T A 16: 38,573,169 F77I possibly damaging Het
Ttn T C 2: 76,781,586 D15578G probably damaging Het
Usp25 T A 16: 77,080,387 M587K probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80905148 missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80905079 critical splice donor site probably null
R9032:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
R9063:Lmnb2 UTSW 10 80906171 missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGATCCTCCAGTTCCCCAAAGAC -3'
(R):5'- TGGACATGGAGATAAGCGCCTACC -3'

Sequencing Primer
(F):5'- CTGGTCCTGCAACCCAGAC -3'
(R):5'- TGCAAGTGGGCAGCATTC -3'
Posted On 2014-02-18