Mutagenetix > Incidental Mutation

Incidental Mutation 'R1324:Lmnb2'

157162

Institutional Source

Beutler Lab

Gene Symbol

Lmnb2

Ensembl Gene

ENSMUSG00000062075

Gene Name

lamin B2

Synonyms

lamin B3

MMRRC Submission

039390-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80737197-80754079 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80740005 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 330 (I330V)

Ref Sequence

ENSEMBL: ENSMUSP00000100969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219817] [ENSMUST00000219896]

AlphaFold

P21619

Predicted Effect

probably benign
Transcript: ENSMUST00000020440

SMART Domains

Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:zf-Tim10_DDP	23	87	4.6e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057623
AA Change: I471V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: I471V

Domain	Start	End	E-Value	Type
Filament	42	398	1.97e-47	SMART
low complexity region	402	422	N/A	INTRINSIC
internal_repeat_1	427	442	1.72e-5	PROSPERO
low complexity region	444	458	N/A	INTRINSIC
Pfam:LTD	462	575	9.3e-16	PFAM
low complexity region	579	596	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105332
AA Change: I330V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: I330V

Domain	Start	End	E-Value	Type
Pfam:Filament	77	257	1.2e-49	PFAM
low complexity region	261	281	N/A	INTRINSIC
Pfam:LTD	317	435	6.7e-23	PFAM
low complexity region	438	455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105333

SMART Domains

Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

Domain	Start	End	E-Value	Type
Pfam:SEA	62	155	1.7e-10	PFAM
LDLa	189	227	1.15e-4	SMART
Tryp_SPc	238	467	2.43e-96	SMART
low complexity region	477	502	N/A	INTRINSIC
Tryp_SPc	539	767	7.28e-86	SMART
Tryp_SPc	867	1093	1.62e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179022
AA Change: I452V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: I452V

Domain	Start	End	E-Value	Type
Pfam:Filament	23	379	8.9e-96	PFAM
low complexity region	383	403	N/A	INTRINSIC
internal_repeat_1	408	423	1.1e-5	PROSPERO
Pfam:LTD	439	557	1.3e-23	PFAM
low complexity region	560	577	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218149

Predicted Effect

probably benign
Transcript: ENSMUST00000218481

Predicted Effect

probably benign
Transcript: ENSMUST00000219817

Predicted Effect

probably benign
Transcript: ENSMUST00000219896

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap10	T	A	11: 61,805,847 (GRCm39)		probably null	Het
Col11a1	A	G	3: 113,824,565 (GRCm39)	R6G	unknown	Het
Enam	A	T	5: 88,641,927 (GRCm39)	Y172F	possibly damaging	Het
Fbxw15	G	A	9: 109,387,314 (GRCm39)	S227F	probably damaging	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Kif21a	A	T	15: 90,832,525 (GRCm39)		probably null	Het
Myom1	T	A	17: 71,359,714 (GRCm39)	I462N	probably damaging	Het
Negr1	C	T	3: 156,774,860 (GRCm39)	A192V	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Nrxn3	T	C	12: 89,221,466 (GRCm39)	I42T	possibly damaging	Het
Pheta2	A	G	15: 82,227,699 (GRCm39)	T73A	probably damaging	Het
Rnf141	G	A	7: 110,416,050 (GRCm39)	R184*	probably null	Het
Serpinb6a	A	T	13: 34,102,343 (GRCm39)	L273H	probably damaging	Het
Thoc6	G	T	17: 23,896,437 (GRCm39)		probably null	Het
Tmem39a	T	A	16: 38,393,531 (GRCm39)	F77I	possibly damaging	Het
Ttn	T	C	2: 76,611,930 (GRCm39)	D15578G	probably damaging	Het
Usp25	T	A	16: 76,877,275 (GRCm39)	M587K	probably damaging	Het

Other mutations in Lmnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Lmnb2	APN	10	80,739,871 (GRCm39)	missense	possibly damaging	0.92
IGL00908:Lmnb2	APN	10	80,745,821 (GRCm39)	missense	probably damaging	0.99
IGL01365:Lmnb2	APN	10	80,740,818 (GRCm39)	missense	probably benign	0.07
IGL01598:Lmnb2	APN	10	80,742,999 (GRCm39)	missense	probably benign	0.00
R0761:Lmnb2	UTSW	10	80,742,088 (GRCm39)	start codon destroyed	probably null	0.03
R1143:Lmnb2	UTSW	10	80,740,149 (GRCm39)	unclassified	probably benign
R1763:Lmnb2	UTSW	10	80,743,025 (GRCm39)	missense	probably damaging	1.00
R2229:Lmnb2	UTSW	10	80,740,226 (GRCm39)	unclassified	probably benign
R5001:Lmnb2	UTSW	10	80,753,946 (GRCm39)	missense	probably damaging	0.98
R5053:Lmnb2	UTSW	10	80,740,489 (GRCm39)	missense	probably damaging	1.00
R5334:Lmnb2	UTSW	10	80,739,791 (GRCm39)	missense	probably benign	0.08
R5713:Lmnb2	UTSW	10	80,741,921 (GRCm39)	missense	probably damaging	0.97
R5975:Lmnb2	UTSW	10	80,740,962 (GRCm39)	nonsense	probably null
R6314:Lmnb2	UTSW	10	80,745,804 (GRCm39)	missense	probably damaging	1.00
R6835:Lmnb2	UTSW	10	80,745,794 (GRCm39)	missense	probably damaging	1.00
R7663:Lmnb2	UTSW	10	80,740,573 (GRCm39)	missense	probably damaging	1.00
R7776:Lmnb2	UTSW	10	80,753,991 (GRCm39)	missense	possibly damaging	0.52
R8230:Lmnb2	UTSW	10	80,740,982 (GRCm39)	missense	probably damaging	0.97
R8728:Lmnb2	UTSW	10	80,740,913 (GRCm39)	critical splice donor site	probably null
R9032:Lmnb2	UTSW	10	80,740,091 (GRCm39)	missense	probably benign	0.03
R9063:Lmnb2	UTSW	10	80,742,005 (GRCm39)	missense	probably benign	0.00
R9085:Lmnb2	UTSW	10	80,740,091 (GRCm39)	missense	probably benign	0.03
Z1176:Lmnb2	UTSW	10	80,739,072 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGATCCTCCAGTTCCCCAAAGAC -3'
(R):5'- TGGACATGGAGATAAGCGCCTACC -3'

Sequencing Primer
(F):5'- CTGGTCCTGCAACCCAGAC -3'
(R):5'- TGCAAGTGGGCAGCATTC -3'

Posted On

2014-02-18