Incidental Mutation 'R1324:Akap10'
ID157163
Institutional Source Beutler Lab
Gene Symbol Akap10
Ensembl Gene ENSMUSG00000047804
Gene NameA kinase (PRKA) anchor protein 10
SynonymsB130049N18Rik, 1500031L16Rik, D-AKAP2
MMRRC Submission 039390-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R1324 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61871307-61930252 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 61915021 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058173] [ENSMUST00000058173] [ENSMUST00000102650] [ENSMUST00000102650] [ENSMUST00000108710] [ENSMUST00000108710]
Predicted Effect probably null
Transcript: ENSMUST00000058173
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058173
SMART Domains Protein: ENSMUSP00000054418
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 46 290 1.82e-30 SMART
RGS 300 426 9.62e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102650
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000102650
SMART Domains Protein: ENSMUSP00000099710
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
PDB:3TMH|L 623 662 2e-18 PDB
Blast:S_TKc 636 661 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000108710
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108710
SMART Domains Protein: ENSMUSP00000104350
Gene: ENSMUSG00000047804

DomainStartEndE-ValueType
RGS 125 369 1.82e-30 SMART
RGS 379 505 9.62e-30 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is localized to mitochondria and interacts with both the type I and type II regulatory subunits of PKA. It has been reported that this protein is important for maintaining heart rate and myocardial contractility through its targeting of protein kinase A. In mouse, defects of this gene lead to cardiac arrhythmias and premature death. In humans, polymorphisms in this gene may be associated with increased risk of arrhythmias and sudden cardiac death. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele display sinus arrhythmia, sinus pauses, and atrioventricular heart block indicating excessive vagus nerve sensitivity; about 50% of homozygous and 25% of heterozygous mutant mice die in the first year of life, and survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col11a1 A G 3: 114,030,916 R6G unknown Het
Enam A T 5: 88,494,068 Y172F possibly damaging Het
Fam109b A G 15: 82,343,498 T73A probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kif21a A T 15: 90,948,322 probably null Het
Lmnb2 T C 10: 80,904,171 I330V possibly damaging Het
Myom1 T A 17: 71,052,719 I462N probably damaging Het
Negr1 C T 3: 157,069,223 A192V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrxn3 T C 12: 89,254,696 I42T possibly damaging Het
Rnf141 G A 7: 110,816,843 R184* probably null Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Thoc6 G T 17: 23,677,463 probably null Het
Tmem39a T A 16: 38,573,169 F77I possibly damaging Het
Ttn T C 2: 76,781,586 D15578G probably damaging Het
Usp25 T A 16: 77,080,387 M587K probably damaging Het
Other mutations in Akap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Akap10 APN 11 61915071 missense possibly damaging 0.85
IGL00971:Akap10 APN 11 61904796 missense possibly damaging 0.68
IGL01510:Akap10 APN 11 61878020 missense possibly damaging 0.74
IGL02731:Akap10 APN 11 61893476 missense possibly damaging 0.78
IGL03289:Akap10 APN 11 61877968 splice site probably benign
IGL03294:Akap10 APN 11 61877353 missense probably damaging 1.00
IGL03403:Akap10 APN 11 61915273 missense probably benign 0.00
P4748:Akap10 UTSW 11 61873020 missense possibly damaging 0.86
R0924:Akap10 UTSW 11 61904863 splice site probably benign
R2117:Akap10 UTSW 11 61890303 missense possibly damaging 0.73
R2243:Akap10 UTSW 11 61915501 missense possibly damaging 0.56
R2402:Akap10 UTSW 11 61915222 missense probably benign
R2567:Akap10 UTSW 11 61893349 intron probably benign
R3745:Akap10 UTSW 11 61915305 missense probably benign
R5124:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5126:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5180:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R5219:Akap10 UTSW 11 61922791 missense probably benign
R5324:Akap10 UTSW 11 61916189 missense probably damaging 1.00
R6753:Akap10 UTSW 11 61886777 missense probably damaging 0.96
R7121:Akap10 UTSW 11 61886698 critical splice donor site probably null
R7763:Akap10 UTSW 11 61915505 missense probably damaging 1.00
R7867:Akap10 UTSW 11 61900446 missense probably damaging 1.00
R7986:Akap10 UTSW 11 61930064 missense probably damaging 1.00
R8079:Akap10 UTSW 11 61930054 missense possibly damaging 0.93
Z1186:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1187:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1188:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1189:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1190:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1191:Akap10 UTSW 11 61915270 missense probably benign 0.00
Z1192:Akap10 UTSW 11 61915270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGACAGTTCCGAGGACCGAGAC -3'
(R):5'- AGAACCACTTGCTGCTTTCCCAG -3'

Sequencing Primer
(F):5'- AGACCTGGAGACTCCCCTTG -3'
(R):5'- TTTCCCAGGAAGGCCACAG -3'
Posted On2014-02-18