Incidental Mutation 'R1325:Krt1'
ID157194
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
MMRRC Submission 039391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R1325 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 101848206 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
Predicted Effect probably null
Transcript: ENSMUST00000023790
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,495,127 I293T possibly damaging Het
Abca14 A G 7: 120,247,322 I666V probably benign Het
Acsl1 G A 8: 46,513,300 V164I probably benign Het
Aox3 C T 1: 58,176,567 Q1053* probably null Het
Arhgap31 A G 16: 38,602,942 S921P probably benign Het
Bcl6 A G 16: 23,972,347 M419T probably benign Het
Bdp1 A G 13: 100,099,008 I145T probably damaging Het
Btaf1 T C 19: 36,969,162 V456A possibly damaging Het
Cry2 T C 2: 92,413,770 T353A probably damaging Het
Dcxr A G 11: 120,726,555 probably null Het
Echdc1 A T 10: 29,317,548 T14S probably benign Het
Fgd6 G A 10: 94,127,427 R1129H probably damaging Het
Fstl1 A G 16: 37,828,721 D197G probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Lrrc9 C A 12: 72,497,104 Q1116K probably damaging Het
Ncor2 T C 5: 125,118,780 probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr531 G A 7: 140,400,881 P55L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Slc17a6 A G 7: 51,661,552 E338G probably benign Het
Ttn A G 2: 76,900,394 probably benign Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101846187 missense unknown
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4893:Krt1 UTSW 15 101850120 missense probably damaging 1.00
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5254:Krt1 UTSW 15 101846368 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5869:Krt1 UTSW 15 101850131 missense probably damaging 1.00
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
RF003:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCGAGATGATGCCATCCAGATCC -3'
(R):5'- GAGGCAAGTTCTCAGCAAGTCAGG -3'

Sequencing Primer
(F):5'- CAGGACAACATTGGTTTCGC -3'
(R):5'- AGGCTAGCTCTTCGGGGTATAT -3'
Posted On2014-02-18