Incidental Mutation 'R1326:Hspd1'
ID 157202
Institutional Source Beutler Lab
Gene Symbol Hspd1
Ensembl Gene ENSMUSG00000025980
Gene Name heat shock protein 1 (chaperonin)
Synonyms Hsp60
MMRRC Submission 039392-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1326 (G1)
Quality Score 172
Status Not validated
Chromosome 1
Chromosomal Location 55116994-55127402 bp(-) (GRCm39)
Type of Mutation splice site (2808 bp from exon)
DNA Base Change (assembly) T to C at 55119418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027123] [ENSMUST00000127861] [ENSMUST00000144077]
AlphaFold P63038
Predicted Effect probably damaging
Transcript: ENSMUST00000027123
AA Change: D353G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027123
Gene: ENSMUSG00000025980
AA Change: D353G

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 550 1.8e-87 PFAM
low complexity region 557 572 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127861
SMART Domains Protein: ENSMUSP00000119336
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 202 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144077
SMART Domains Protein: ENSMUSP00000122947
Gene: ENSMUSG00000025980

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 47 142 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit embryonic lethality between E7.5 and E9.75 associated with growth retardation. Males heterozygous for a gene-trap allele produce fewer female offspring than expected. Heterozygotes develop a slowly progressive motor defect resembling spastic paraplegia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 G A 12: 52,565,153 (GRCm39) S708N possibly damaging Het
Armc3 T C 2: 19,314,935 (GRCm39) *882Q probably null Het
Atp13a3 G A 16: 30,171,128 (GRCm39) L306F probably damaging Het
Cyp2d9 T C 15: 82,339,357 (GRCm39) I130T possibly damaging Het
Ect2l C T 10: 18,041,290 (GRCm39) R296H probably benign Het
Eomes C T 9: 118,313,565 (GRCm39) Q518* probably null Het
Errfi1 T C 4: 150,949,621 (GRCm39) V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 (GRCm38) N407S probably benign Het
Fpgs T C 2: 32,582,592 (GRCm39) probably null Het
Fsbp A G 4: 11,579,891 (GRCm39) Y53C probably damaging Het
Ifna7 A T 4: 88,734,931 (GRCm39) E156V possibly damaging Het
Map1a C T 2: 121,136,671 (GRCm39) Q2258* probably null Het
Mier2 A G 10: 79,380,543 (GRCm39) F289S probably damaging Het
Mmp16 A G 4: 18,054,517 (GRCm39) N341S possibly damaging Het
Moxd2 T C 6: 40,857,288 (GRCm39) T491A probably benign Het
Narf T A 11: 121,133,379 (GRCm39) L60Q probably damaging Het
Pa2g4 T C 10: 128,395,142 (GRCm39) D341G probably benign Het
Parp1 T A 1: 180,428,023 (GRCm39) V991D probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc1a4 A G 11: 20,282,159 (GRCm39) L105P probably damaging Het
Slc27a2 T A 2: 126,406,690 (GRCm39) Y125N probably damaging Het
Sorl1 A G 9: 41,943,092 (GRCm39) V928A probably benign Het
Spata31e2 G T 1: 26,723,011 (GRCm39) P723H probably damaging Het
Usp31 G C 7: 121,247,525 (GRCm39) S1306C probably damaging Het
Other mutations in Hspd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Hspd1 APN 1 55,120,285 (GRCm39) missense probably damaging 0.98
IGL01896:Hspd1 APN 1 55,118,268 (GRCm39) missense probably benign 0.01
IGL03295:Hspd1 APN 1 55,119,334 (GRCm39) missense probably benign 0.00
R0035:Hspd1 UTSW 1 55,122,942 (GRCm39) missense probably benign 0.05
R0051:Hspd1 UTSW 1 55,121,205 (GRCm39) unclassified probably benign
R0051:Hspd1 UTSW 1 55,121,205 (GRCm39) unclassified probably benign
R2163:Hspd1 UTSW 1 55,117,697 (GRCm39) unclassified probably benign
R2851:Hspd1 UTSW 1 55,120,256 (GRCm39) missense probably damaging 1.00
R2852:Hspd1 UTSW 1 55,120,256 (GRCm39) missense probably damaging 1.00
R2853:Hspd1 UTSW 1 55,120,256 (GRCm39) missense probably damaging 1.00
R4196:Hspd1 UTSW 1 55,126,068 (GRCm39) missense probably benign
R5590:Hspd1 UTSW 1 55,123,928 (GRCm39) missense probably damaging 1.00
R5742:Hspd1 UTSW 1 55,123,766 (GRCm39) missense probably benign 0.08
R6600:Hspd1 UTSW 1 55,117,777 (GRCm39) missense probably benign 0.02
R7120:Hspd1 UTSW 1 55,118,388 (GRCm39) missense probably benign 0.01
R7604:Hspd1 UTSW 1 55,119,496 (GRCm39) missense probably benign 0.00
R7814:Hspd1 UTSW 1 55,117,803 (GRCm39) missense possibly damaging 0.90
R7980:Hspd1 UTSW 1 55,117,785 (GRCm39) missense possibly damaging 0.50
R8059:Hspd1 UTSW 1 55,120,883 (GRCm39) missense possibly damaging 0.90
R8472:Hspd1 UTSW 1 55,117,505 (GRCm39) missense probably benign 0.03
R8709:Hspd1 UTSW 1 55,120,922 (GRCm39) missense probably benign 0.01
R9466:Hspd1 UTSW 1 55,119,483 (GRCm39) missense probably benign 0.03
Z1177:Hspd1 UTSW 1 55,119,425 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGCAAGTCAGTCTTACCTTCAAC -3'
(R):5'- TGCTGAGCCTGGCGTGAGAATG -3'

Sequencing Primer
(F):5'- GTCAGTCTTACCTTCAACACAGC -3'
(R):5'- gcgtccatccagtcccatag -3'
Posted On 2014-02-18