Incidental Mutation 'R1326:Eomes'
ID157219
Institutional Source Beutler Lab
Gene Symbol Eomes
Ensembl Gene ENSMUSG00000032446
Gene Nameeomesodermin
SynonymsTbr2
MMRRC Submission 039392-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1326 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118478212-118486132 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 118484497 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 518 (Q518*)
Ref Sequence ENSEMBL: ENSMUSP00000107393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035020] [ENSMUST00000111763] [ENSMUST00000150633]
Predicted Effect probably null
Transcript: ENSMUST00000035020
AA Change: Q537*
SMART Domains Protein: ENSMUSP00000035020
Gene: ENSMUSG00000032446
AA Change: Q537*

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 7.3e-120 SMART
Pfam:T-box_assoc 484 705 1.6e-101 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111763
AA Change: Q518*
SMART Domains Protein: ENSMUSP00000107393
Gene: ENSMUSG00000032446
AA Change: Q518*

DomainStartEndE-ValueType
low complexity region 73 96 N/A INTRINSIC
low complexity region 127 134 N/A INTRINSIC
low complexity region 211 240 N/A INTRINSIC
low complexity region 246 266 N/A INTRINSIC
TBOX 268 463 5.53e-120 SMART
Blast:TBOX 485 511 6e-8 BLAST
low complexity region 648 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150633
SMART Domains Protein: ENSMUSP00000118079
Gene: ENSMUSG00000032446

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 60 67 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
TBOX 201 395 8.01e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212286
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TBR1 (T-box brain protein 1) sub-family of T-box genes that share the common DNA-binding T-box domain. The encoded protein is a transcription factor which is crucial for embryonic development of mesoderm and the central nervous system in vertebrates. The protein may also be necessary for the differentiation of effector CD8+ T cells which are involved in defense against viral infections. A similar gene disrupted in mice is shown to be essential during trophoblast development and gastrulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality, fail to implant, and lack trophoectoderm outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,683,930 P723H probably damaging Het
Arhgap5 G A 12: 52,518,370 S708N possibly damaging Het
Armc3 T C 2: 19,310,124 *882Q probably null Het
Atp13a3 G A 16: 30,352,310 L306F probably damaging Het
Cyp2d9 T C 15: 82,455,156 I130T possibly damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Errfi1 T C 4: 150,865,164 V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fpgs T C 2: 32,692,580 probably null Het
Fsbp A G 4: 11,579,891 Y53C probably damaging Het
Hspd1 T C 1: 55,080,259 probably null Het
Ifna7 A T 4: 88,816,694 E156V possibly damaging Het
Map1a C T 2: 121,306,190 Q2258* probably null Het
Mier2 A G 10: 79,544,709 F289S probably damaging Het
Mmp16 A G 4: 18,054,517 N341S possibly damaging Het
Moxd2 T C 6: 40,880,354 T491A probably benign Het
Narf T A 11: 121,242,553 L60Q probably damaging Het
Pa2g4 T C 10: 128,559,273 D341G probably benign Het
Parp1 T A 1: 180,600,458 V991D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc1a4 A G 11: 20,332,159 L105P probably damaging Het
Slc27a2 T A 2: 126,564,770 Y125N probably damaging Het
Sorl1 A G 9: 42,031,796 V928A probably benign Het
Usp31 G C 7: 121,648,302 S1306C probably damaging Het
Other mutations in Eomes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Eomes APN 9 118482266 missense probably damaging 1.00
IGL01322:Eomes APN 9 118484830 missense probably benign 0.14
IGL01532:Eomes APN 9 118482249 missense probably damaging 1.00
R0088:Eomes UTSW 9 118478673 missense probably damaging 0.99
R0305:Eomes UTSW 9 118484757 missense probably benign 0.11
R0894:Eomes UTSW 9 118482300 splice site probably null
R1110:Eomes UTSW 9 118484599 missense probably benign 0.29
R1942:Eomes UTSW 9 118484648 missense probably benign 0.01
R2108:Eomes UTSW 9 118478852 missense probably benign 0.09
R2237:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2238:Eomes UTSW 9 118482291 missense probably damaging 1.00
R2239:Eomes UTSW 9 118482291 missense probably damaging 1.00
R3915:Eomes UTSW 9 118481273 missense probably benign 0.01
R4158:Eomes UTSW 9 118478963 missense probably benign
R5274:Eomes UTSW 9 118480529 missense probably damaging 1.00
R6894:Eomes UTSW 9 118481285 missense probably damaging 1.00
R7055:Eomes UTSW 9 118480499 missense possibly damaging 0.57
R7115:Eomes UTSW 9 118484489 missense probably benign 0.00
R8053:Eomes UTSW 9 118480553 missense probably damaging 1.00
X0021:Eomes UTSW 9 118482258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGCAGCACAACTCTCTAGCTTC -3'
(R):5'- CATCTTCCTCTGATAAGCGCCACG -3'

Sequencing Primer
(F):5'- TAGCATGTACACGGCTTCAG -3'
(R):5'- ATAAGCGCCACGGCCTC -3'
Posted On2014-02-18