Incidental Mutation 'R1326:Cyp2d9'
ID157230
Institutional Source Beutler Lab
Gene Symbol Cyp2d9
Ensembl Gene ENSMUSG00000068086
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 9
SynonymsCyp2d, testosterone 16alpha-hydroxylase, P450-2D
MMRRC Submission 039392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1326 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82433437-82456845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82455156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 130 (I130T)
Ref Sequence ENSEMBL: ENSMUSP00000155410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089129] [ENSMUST00000229313] [ENSMUST00000229473] [ENSMUST00000229793] [ENSMUST00000230000] [ENSMUST00000230024] [ENSMUST00000230191] [ENSMUST00000231136]
Predicted Effect probably benign
Transcript: ENSMUST00000089129
AA Change: I253T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086530
Gene: ENSMUSG00000068086
AA Change: I253T

DomainStartEndE-ValueType
Pfam:p450 37 497 1.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229181
Predicted Effect probably benign
Transcript: ENSMUST00000229313
Predicted Effect probably benign
Transcript: ENSMUST00000229473
Predicted Effect probably benign
Transcript: ENSMUST00000229793
Predicted Effect possibly damaging
Transcript: ENSMUST00000230000
AA Change: I130T

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000230024
AA Change: I42T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000230191
AA Change: I253T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000231136
AA Change: I223T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,683,930 P723H probably damaging Het
Arhgap5 G A 12: 52,518,370 S708N possibly damaging Het
Armc3 T C 2: 19,310,124 *882Q probably null Het
Atp13a3 G A 16: 30,352,310 L306F probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Eomes C T 9: 118,484,497 Q518* probably null Het
Errfi1 T C 4: 150,865,164 V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fpgs T C 2: 32,692,580 probably null Het
Fsbp A G 4: 11,579,891 Y53C probably damaging Het
Hspd1 T C 1: 55,080,259 probably null Het
Ifna7 A T 4: 88,816,694 E156V possibly damaging Het
Map1a C T 2: 121,306,190 Q2258* probably null Het
Mier2 A G 10: 79,544,709 F289S probably damaging Het
Mmp16 A G 4: 18,054,517 N341S possibly damaging Het
Moxd2 T C 6: 40,880,354 T491A probably benign Het
Narf T A 11: 121,242,553 L60Q probably damaging Het
Pa2g4 T C 10: 128,559,273 D341G probably benign Het
Parp1 T A 1: 180,600,458 V991D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc1a4 A G 11: 20,332,159 L105P probably damaging Het
Slc27a2 T A 2: 126,564,770 Y125N probably damaging Het
Sorl1 A G 9: 42,031,796 V928A probably benign Het
Usp31 G C 7: 121,648,302 S1306C probably damaging Het
Other mutations in Cyp2d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cyp2d9 APN 15 82455094 missense probably benign 0.05
IGL00587:Cyp2d9 APN 15 82455143 missense possibly damaging 0.89
IGL00815:Cyp2d9 APN 15 82456375 missense possibly damaging 0.94
IGL03023:Cyp2d9 APN 15 82455518 missense probably damaging 0.99
IGL03410:Cyp2d9 APN 15 82456699 missense probably benign 0.00
R0417:Cyp2d9 UTSW 15 82455951 missense probably damaging 1.00
R0627:Cyp2d9 UTSW 15 82455790 missense probably damaging 1.00
R1501:Cyp2d9 UTSW 15 82454324 nonsense probably null
R1893:Cyp2d9 UTSW 15 82452606 missense probably damaging 0.97
R2496:Cyp2d9 UTSW 15 82452479 missense probably damaging 1.00
R2519:Cyp2d9 UTSW 15 82454518 splice site probably null
R3155:Cyp2d9 UTSW 15 82452642 critical splice donor site probably null
R4691:Cyp2d9 UTSW 15 82455832 missense probably damaging 1.00
R4727:Cyp2d9 UTSW 15 82454401 start codon destroyed probably null 0.99
R4770:Cyp2d9 UTSW 15 82452573 missense probably damaging 0.98
R5319:Cyp2d9 UTSW 15 82454055 missense probably damaging 1.00
R5486:Cyp2d9 UTSW 15 82452578 missense probably damaging 0.96
R5516:Cyp2d9 UTSW 15 82454327 missense probably null 1.00
R5646:Cyp2d9 UTSW 15 82452464 missense probably benign 0.01
R5898:Cyp2d9 UTSW 15 82455524 missense probably benign 0.02
R6193:Cyp2d9 UTSW 15 82452527 missense probably benign 0.01
R6288:Cyp2d9 UTSW 15 82456415 missense probably damaging 1.00
R6924:Cyp2d9 UTSW 15 82455212 missense probably damaging 1.00
R7524:Cyp2d9 UTSW 15 82455945 missense probably damaging 1.00
R7525:Cyp2d9 UTSW 15 82454092 missense possibly damaging 0.91
R7731:Cyp2d9 UTSW 15 82455432 critical splice acceptor site probably null
R7889:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTGATACTGAGCATCCCTAGCAC -3'
(R):5'- ATCTTGCCTCACAGCTCACAGGAC -3'

Sequencing Primer
(F):5'- caagcaagccagccaac -3'
(R):5'- GCTCACAGGACCTCAGC -3'
Posted On2014-02-18