Mutagenetix > Incidental Mutations

Incidental Mutation 'R1327:Fh1'

157234

Institutional Source

Beutler Lab

Gene Symbol

Fh1

Ensembl Gene

ENSMUSG00000026526

Gene Name

fumarate hydratase 1

Synonyms

fumarase

MMRRC Submission

039393-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1327 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

175600374-175625635 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 175609744 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 263 (M263T)

Ref Sequence

ENSEMBL: ENSMUSP00000027810 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027810]

Predicted Effect

probably benign
Transcript: ENSMUST00000027810
AA Change: M263T

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: M263T

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:Lyase_1	55	386	1.8e-124	PFAM
Pfam:FumaraseC_C	452	505	2.5e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133218

Predicted Effect

probably benign
Transcript: ENSMUST00000176740

Meta Mutation Damage Score

0.7602

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.8%
20x: 88.1%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd3	T	C	1: 180,733,183	F99L	possibly damaging	Het
Arg1	T	C	10: 24,920,804		probably null	Het
Bsnd	C	T	4: 106,486,612	E166K	probably benign	Het
Cxcl9	A	G	5: 92,326,850	C30R	probably damaging	Het
Cyhr1	T	A	15: 76,649,176	T121S	probably damaging	Het
Ect2l	C	T	10: 18,165,542	R296H	probably benign	Het
Epha5	C	A	5: 84,106,785	D632Y	probably damaging	Het
Fbxw11	T	C	11: 32,711,859	Y79H	probably benign	Het
Gm14124	A	T	2: 150,266,150	H10L	possibly damaging	Het
Mrgprb1	A	T	7: 48,447,429	I245N	possibly damaging	Het
Ms4a13	A	T	19: 11,183,887	I96N	probably damaging	Het
Nipa2	G	A	7: 55,944,508	L38F	possibly damaging	Het
Pappa	T	A	4: 65,351,603		probably benign	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf111	A	T	9: 70,453,816	D454E	possibly damaging	Het
Rp1	C	T	1: 4,347,970	G973D	probably benign	Het
Rtn3	A	G	19: 7,431,011	V922A	possibly damaging	Het
Setbp1	T	C	18: 78,783,358	M1347V	probably benign	Het
Slc6a6	A	G	6: 91,726,035	I130V	probably benign	Het
Smad7	T	C	18: 75,375,945	S48P	probably benign	Het
Star	A	G	8: 25,809,837	D69G	probably benign	Het
Syne1	C	A	10: 5,048,925		probably benign	Het
Synj1	A	T	16: 90,946,855	N1212K	probably benign	Het
Tep1	T	C	14: 50,853,099	M721V	probably benign	Het
Txndc11	T	C	16: 11,116,814	D223G	possibly damaging	Het
Vit	G	A	17: 78,625,200	D579N	probably damaging	Het
Zan	T	C	5: 137,465,911		probably benign	Het
Zfp318	A	G	17: 46,413,263	E2064G	probably damaging	Het
Zic5	T	G	14: 122,459,779		probably benign	Het
Zzef1	T	C	11: 72,893,414		probably null	Het

Other mutations in Fh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:Fh1	APN	1	175601542	missense	probably damaging	1.00
IGL02637:Fh1	APN	1	175609766	missense	probably benign	0.00
IGL02954:Fh1	APN	1	175609735	missense	probably damaging	1.00
IGL03056:Fh1	APN	1	175606162	missense	probably damaging	1.00
IGL03309:Fh1	APN	1	175604043	missense	probably benign	0.01
R0729:Fh1	UTSW	1	175614817	missense	probably damaging	1.00
R1240:Fh1	UTSW	1	175604015	missense	probably damaging	1.00
R1576:Fh1	UTSW	1	175607819	missense	probably null	1.00
R1779:Fh1	UTSW	1	175601424	makesense	probably null
R1823:Fh1	UTSW	1	175616548	missense	probably damaging	1.00
R1851:Fh1	UTSW	1	175607886	missense	probably damaging	1.00
R1943:Fh1	UTSW	1	175609778	missense	probably benign
R2163:Fh1	UTSW	1	175614840	missense	possibly damaging	0.80
R3766:Fh1	UTSW	1	175614750	missense	probably damaging	1.00
R4193:Fh1	UTSW	1	175614841	missense	possibly damaging	0.51
R4672:Fh1	UTSW	1	175604051	missense	probably benign	0.07
R4812:Fh1	UTSW	1	175601459	missense	probably damaging	0.99
R4849:Fh1	UTSW	1	175620506	missense	probably benign	0.00
R4905:Fh1	UTSW	1	175619073	missense	probably damaging	1.00
R4978:Fh1	UTSW	1	175603967	missense	probably damaging	1.00
R6645:Fh1	UTSW	1	175614876	missense	possibly damaging	0.94
R6681:Fh1	UTSW	1	175619124	missense	probably null	0.71
R7075:Fh1	UTSW	1	175607855	missense	probably benign	0.00
R7646:Fh1	UTSW	1	175614913	missense	probably benign	0.03
R7783:Fh1	UTSW	1	175612178	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACACAAGCCATGTTTGATGGGA -3'
(R):5'- GGATCAGCTCACTGGGTGGATTGTA -3'

Sequencing Primer
(F):5'- CTCCTTAATTTCAGAAGAATTCAGCC -3'
(R):5'- CAGTGTAGTGGAGCTATTCTTAAAG -3'

Posted On

2014-02-18