Incidental Mutation 'R1327:Fh1'
ID157234
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Namefumarate hydratase 1
Synonymsfumarase
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175600374-175625635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175609744 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 263 (M263T)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810]
Predicted Effect probably benign
Transcript: ENSMUST00000027810
AA Change: M263T

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: M263T

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133218
Predicted Effect probably benign
Transcript: ENSMUST00000176740
Meta Mutation Damage Score 0.7602 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175601542 missense probably damaging 1.00
IGL02637:Fh1 APN 1 175609766 missense probably benign 0.00
IGL02954:Fh1 APN 1 175609735 missense probably damaging 1.00
IGL03056:Fh1 APN 1 175606162 missense probably damaging 1.00
IGL03309:Fh1 APN 1 175604043 missense probably benign 0.01
R0729:Fh1 UTSW 1 175614817 missense probably damaging 1.00
R1240:Fh1 UTSW 1 175604015 missense probably damaging 1.00
R1576:Fh1 UTSW 1 175607819 missense probably null 1.00
R1779:Fh1 UTSW 1 175601424 makesense probably null
R1823:Fh1 UTSW 1 175616548 missense probably damaging 1.00
R1851:Fh1 UTSW 1 175607886 missense probably damaging 1.00
R1943:Fh1 UTSW 1 175609778 missense probably benign
R2163:Fh1 UTSW 1 175614840 missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175614750 missense probably damaging 1.00
R4193:Fh1 UTSW 1 175614841 missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175604051 missense probably benign 0.07
R4812:Fh1 UTSW 1 175601459 missense probably damaging 0.99
R4849:Fh1 UTSW 1 175620506 missense probably benign 0.00
R4905:Fh1 UTSW 1 175619073 missense probably damaging 1.00
R4978:Fh1 UTSW 1 175603967 missense probably damaging 1.00
R6645:Fh1 UTSW 1 175614876 missense possibly damaging 0.94
R6681:Fh1 UTSW 1 175619124 missense probably null 0.71
R7075:Fh1 UTSW 1 175607855 missense probably benign 0.00
R7646:Fh1 UTSW 1 175614913 missense probably benign 0.03
R7783:Fh1 UTSW 1 175612178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACAAGCCATGTTTGATGGGA -3'
(R):5'- GGATCAGCTCACTGGGTGGATTGTA -3'

Sequencing Primer
(F):5'- CTCCTTAATTTCAGAAGAATTCAGCC -3'
(R):5'- CAGTGTAGTGGAGCTATTCTTAAAG -3'
Posted On2014-02-18