Incidental Mutation 'R1327:Bsnd'
ID157239
Institutional Source Beutler Lab
Gene Symbol Bsnd
Ensembl Gene ENSMUSG00000025418
Gene Namebarttin CLCNK type accessory beta subunit
Synonyms
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106483456-106492283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106486612 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 166 (E166K)
Ref Sequence ENSEMBL: ENSMUSP00000049563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054472]
Predicted Effect probably benign
Transcript: ENSMUST00000054472
AA Change: E166K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049563
Gene: ENSMUSG00000025418
AA Change: E166K

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Barttin 27 241 5.2e-110 PFAM
low complexity region 273 280 N/A INTRINSIC
Meta Mutation Damage Score 0.0798 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe dehydration and postnatal lethality. Mice homozygous for a cre-activated conditional allele exhibit hearing loss with outer hair cell and stria vascularis degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Bsnd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03220:Bsnd APN 4 106486765 missense possibly damaging 0.58
IGL02802:Bsnd UTSW 4 106492034 missense probably damaging 1.00
R1869:Bsnd UTSW 4 106486636 missense probably benign 0.03
R1912:Bsnd UTSW 4 106488030 nonsense probably null
R4294:Bsnd UTSW 4 106485158 missense probably benign 0.01
R4411:Bsnd UTSW 4 106486671 missense probably benign
R5241:Bsnd UTSW 4 106487985 missense probably benign 0.21
R5733:Bsnd UTSW 4 106488001 missense probably benign 0.08
R6274:Bsnd UTSW 4 106486635 missense probably damaging 0.96
R6483:Bsnd UTSW 4 106488015 missense probably damaging 0.99
R7153:Bsnd UTSW 4 106492033 missense probably benign 0.09
R7184:Bsnd UTSW 4 106491912 missense probably damaging 1.00
X0023:Bsnd UTSW 4 106485417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGTGAGAGAAACTGCTTG -3'
(R):5'- TATGACCAGAGCCTCCCAGACTTC -3'

Sequencing Primer
(F):5'- CTGCTTGGGAGAGTCTAAAACC -3'
(R):5'- TTCACTCACATCCAAATGAAGGTC -3'
Posted On2014-02-18