Incidental Mutation 'R1327:Cxcl9'
ID157242
Institutional Source Beutler Lab
Gene Symbol Cxcl9
Ensembl Gene ENSMUSG00000029417
Gene Namechemokine (C-X-C motif) ligand 9
SynonymsMig, CMK, crg-10, Scyb9
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92321347-92328079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92326850 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 30 (C30R)
Ref Sequence ENSEMBL: ENSMUSP00000108716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113083] [ENSMUST00000113093] [ENSMUST00000121096] [ENSMUST00000125462] [ENSMUST00000154245]
Predicted Effect probably benign
Transcript: ENSMUST00000113083
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113093
AA Change: C30R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108716
Gene: ENSMUSG00000029417
AA Change: C30R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCY 27 88 2.08e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121096
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125462
SMART Domains Protein: ENSMUSP00000117995
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 244 1.4e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135528
Predicted Effect probably benign
Transcript: ENSMUST00000154245
SMART Domains Protein: ENSMUSP00000119283
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 178 4.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202404
Meta Mutation Damage Score 0.9397 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a significant reduction in CD4+ T cell infiltration into the cornea in response to ocular HSV-1 infection, and produce lower titers of antibodies in response to primary infection with the intracellular bacterium Francisella tularensis live vaccine strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Cxcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cxcl9 APN 5 92323869 missense possibly damaging 0.53
R1476:Cxcl9 UTSW 5 92325113 missense probably damaging 1.00
R5752:Cxcl9 UTSW 5 92323856 missense probably benign
R7215:Cxcl9 UTSW 5 92323888 nonsense probably null
R7839:Cxcl9 UTSW 5 92328010 missense probably benign 0.00
R7922:Cxcl9 UTSW 5 92328010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGTTCCTACACTCTCAGATGG -3'
(R):5'- AAAATGAAGTTCTTCCCCTGCTCCC -3'

Sequencing Primer
(F):5'- GGCCTCCTGCCTACATGAAC -3'
(R):5'- AAATGACTTTGCCCTTAACCTTGG -3'
Posted On2014-02-18