Incidental Mutation 'R1327:Slc6a6'
ID 157244
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 039393-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1327 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91703016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 130 (I130V)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185] [ENSMUST00000205480] [ENSMUST00000205828] [ENSMUST00000206545]
AlphaFold O35316
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: I130V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: I130V

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205443
Predicted Effect probably benign
Transcript: ENSMUST00000205480
Predicted Effect unknown
Transcript: ENSMUST00000205663
AA Change: H14R
Predicted Effect probably benign
Transcript: ENSMUST00000205828
Predicted Effect probably benign
Transcript: ENSMUST00000206545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206835
Meta Mutation Damage Score 0.1708 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,560,748 (GRCm39) F99L possibly damaging Het
Arg1 T C 10: 24,796,702 (GRCm39) probably null Het
Bsnd C T 4: 106,343,809 (GRCm39) E166K probably benign Het
Cxcl9 A G 5: 92,474,709 (GRCm39) C30R probably damaging Het
Ect2l C T 10: 18,041,290 (GRCm39) R296H probably benign Het
Epha5 C A 5: 84,254,644 (GRCm39) D632Y probably damaging Het
Fbxw11 T C 11: 32,661,859 (GRCm39) Y79H probably benign Het
Fh1 A G 1: 175,437,310 (GRCm39) M263T probably benign Het
Mrgprb1 A T 7: 48,097,177 (GRCm39) I245N possibly damaging Het
Ms4a13 A T 19: 11,161,251 (GRCm39) I96N probably damaging Het
Nipa2 G A 7: 55,594,256 (GRCm39) L38F possibly damaging Het
Pappa T A 4: 65,269,840 (GRCm39) probably benign Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rnf111 A T 9: 70,361,098 (GRCm39) D454E possibly damaging Het
Rp1 C T 1: 4,418,193 (GRCm39) G973D probably benign Het
Rtn3 A G 19: 7,408,376 (GRCm39) V922A possibly damaging Het
Setbp1 T C 18: 78,826,573 (GRCm39) M1347V probably benign Het
Smad7 T C 18: 75,509,016 (GRCm39) S48P probably benign Het
Star A G 8: 26,299,865 (GRCm39) D69G probably benign Het
Syne1 C A 10: 4,998,925 (GRCm39) probably benign Het
Synj1 A T 16: 90,743,743 (GRCm39) N1212K probably benign Het
Tep1 T C 14: 51,090,556 (GRCm39) M721V probably benign Het
Txndc11 T C 16: 10,934,678 (GRCm39) D223G possibly damaging Het
Vit G A 17: 78,932,629 (GRCm39) D579N probably damaging Het
Zan T C 5: 137,464,173 (GRCm39) probably benign Het
Zfp1005 A T 2: 150,108,070 (GRCm39) H10L possibly damaging Het
Zfp318 A G 17: 46,724,189 (GRCm39) E2064G probably damaging Het
Zftraf1 T A 15: 76,533,376 (GRCm39) T121S probably damaging Het
Zic5 T G 14: 122,697,191 (GRCm39) probably benign Het
Zzef1 T C 11: 72,784,240 (GRCm39) probably null Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCACAGTCAGTGTCCTGACC -3'
(R):5'- AGACCCAGTGACTCTCGTTCCTAC -3'

Sequencing Primer
(F):5'- cagtGTCCTGACCCCACTTC -3'
(R):5'- GACTCTCGTTCCTACGCAGG -3'
Posted On 2014-02-18