Incidental Mutation 'R1327:Mrgprb1'
ID157245
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene NameMAS-related GPR, member B1
SynonymsMrgB1
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48444113-48456342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48447429 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 245 (I245N)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094384
AA Change: I245N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: I245N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48447543 missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48448027 missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48448006 missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48447661 missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48447717 missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48447204 missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48447214 missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48456184 splice site probably benign
R1223:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R1456:Mrgprb1 UTSW 7 48448029 missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48447125 unclassified probably null
R1567:Mrgprb1 UTSW 7 48447453 missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48447322 missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48447721 missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48447328 missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48448081 missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48447123 missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48447708 missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48447991 missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48447477 missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48447971 missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48447775 missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48447684 missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48447820 missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48447897 missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48447676 missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48447687 missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48447583 missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48448147
Predicted Primers PCR Primer
(F):5'- AGCTTGAGAGTCTTCCGTTGAAACC -3'
(R):5'- ACTGTCATTAGCACTGAACGCTTCC -3'

Sequencing Primer
(F):5'- TTGAAACCGATGGTGCCTAATG -3'
(R):5'- GGAATGTGGCTTCCTATATTACAC -3'
Posted On2014-02-18