Incidental Mutation 'R1327:Nipa2'
ID157246
Institutional Source Beutler Lab
Gene Symbol Nipa2
Ensembl Gene ENSMUSG00000030452
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55931287-55962476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55944508 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 38 (L38F)
Ref Sequence ENSEMBL: ENSMUSP00000114020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032635] [ENSMUST00000117812] [ENSMUST00000119041] [ENSMUST00000119201] [ENSMUST00000126604] [ENSMUST00000143325] [ENSMUST00000152649]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032635
AA Change: L38F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032635
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117812
AA Change: L38F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113727
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 8 302 1.4e-151 PFAM
Pfam:EamA 47 128 4.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119041
AA Change: L38F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112394
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119201
AA Change: L38F

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114020
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126604
AA Change: L38F

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116219
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 130 1.2e-66 PFAM
Pfam:EmrE 14 130 1.8e-11 PFAM
Pfam:EamA 50 128 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135849
Predicted Effect probably benign
Transcript: ENSMUST00000143325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147950
Predicted Effect probably benign
Transcript: ENSMUST00000152649
AA Change: L38F

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120798
Gene: ENSMUSG00000030452
AA Change: L38F

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 127 1.9e-53 PFAM
Pfam:EamA 10 109 1.8e-9 PFAM
Pfam:EmrE 18 116 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205773
Meta Mutation Damage Score 0.1013 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Nipa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Nipa2 APN 7 55933445 missense probably damaging 1.00
IGL01965:Nipa2 APN 7 55944623 start gained probably benign
IGL02373:Nipa2 APN 7 55933128 missense probably benign 0.01
IGL02812:Nipa2 APN 7 55943018 missense probably damaging 1.00
IGL03079:Nipa2 APN 7 55933457 missense probably damaging 1.00
IGL03188:Nipa2 APN 7 55932932 missense probably benign
R2356:Nipa2 UTSW 7 55932966 missense probably benign 0.00
R3758:Nipa2 UTSW 7 55935941 missense probably damaging 1.00
R3870:Nipa2 UTSW 7 55932942 missense probably damaging 1.00
R4684:Nipa2 UTSW 7 55935826 missense probably benign
R4775:Nipa2 UTSW 7 55935863 missense probably benign 0.19
R5285:Nipa2 UTSW 7 55933012 nonsense probably null
R6453:Nipa2 UTSW 7 55935821 missense probably damaging 0.98
R6880:Nipa2 UTSW 7 55933251 missense probably damaging 0.99
R7459:Nipa2 UTSW 7 55933341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGAAACTCCTTTGGCACTG -3'
(R):5'- AGGATTGCGTCACCTTGTCTCCTG -3'

Sequencing Primer
(F):5'- GGTCCCATTCCTATTTTGACAGTAAC -3'
(R):5'- GTACAAGCAGTTTCTCTGTTCG -3'
Posted On2014-02-18