Incidental Mutation 'R1327:Star'
ID157247
Institutional Source Beutler Lab
Gene Symbol Star
Ensembl Gene ENSMUSG00000031574
Gene Namesteroidogenic acute regulatory protein
SynonymsD8Ertd419e
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25806555-25815982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25809837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000148087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033979] [ENSMUST00000210565]
Predicted Effect probably benign
Transcript: ENSMUST00000033979
AA Change: D69G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033979
Gene: ENSMUSG00000031574
AA Change: D69G

DomainStartEndE-ValueType
START 75 280 3.63e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210565
AA Change: D69G

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice fail to thrive and die during the postnatal period due to adrenocortical insufficiency. Mice exhibit male pseudohermaprhoditism and show a progressive accumulation of lipids within steroidogenic cells of the adrenal glands and gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Star
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Star APN 8 25812866 unclassified probably null
IGL01337:Star APN 8 25809864 missense probably damaging 1.00
IGL02165:Star APN 8 25812815 missense possibly damaging 0.75
IGL03274:Star APN 8 25811054 missense possibly damaging 0.72
R3816:Star UTSW 8 25809877 missense probably benign 0.15
R4790:Star UTSW 8 25808616 missense probably damaging 0.99
R5490:Star UTSW 8 25809917 missense probably damaging 1.00
R6362:Star UTSW 8 25811807 missense probably benign 0.18
R6964:Star UTSW 8 25811823 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGGATTAAGGCACCAAGCTG -3'
(R):5'- TGAGCATGGTAGTGGGACCATCAG -3'

Sequencing Primer
(F):5'- GCTCAACTGGAGAGCACTG -3'
(R):5'- TAGTGGGACCATCAGTAACTGC -3'
Posted On2014-02-18