Incidental Mutation 'R1327:Rnf111'
ID157248
Institutional Source Beutler Lab
Gene Symbol Rnf111
Ensembl Gene ENSMUSG00000032217
Gene Namering finger 111
SynonymsArkadia
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70425424-70503725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70453816 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 454 (D454E)
Ref Sequence ENSEMBL: ENSMUSP00000149501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]
Predicted Effect probably benign
Transcript: ENSMUST00000034739
AA Change: D454E

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: D454E

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 2.5e-112 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113595
AA Change: D454E

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: D454E

DomainStartEndE-ValueType
Pfam:RNF111_N 18 290 1.8e-97 PFAM
low complexity region 340 355 N/A INTRINSIC
low complexity region 503 518 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 759 776 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
RING 937 977 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213208
Predicted Effect possibly damaging
Transcript: ENSMUST00000213647
AA Change: D454E

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213694
Predicted Effect probably benign
Transcript: ENSMUST00000215848
AA Change: D454E

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215948
Meta Mutation Damage Score 0.0745 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zfp318 A G 17: 46,413,263 E2064G probably damaging Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Rnf111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Rnf111 APN 9 70440858 missense probably damaging 1.00
IGL02567:Rnf111 APN 9 70459005 missense probably damaging 1.00
R0052:Rnf111 UTSW 9 70476389 missense probably benign 0.00
R0245:Rnf111 UTSW 9 70453831 splice site probably benign
R0760:Rnf111 UTSW 9 70429678 missense probably damaging 1.00
R1778:Rnf111 UTSW 9 70476112 missense probably benign 0.00
R1884:Rnf111 UTSW 9 70476238 missense probably damaging 0.99
R1892:Rnf111 UTSW 9 70476374 missense probably damaging 1.00
R2261:Rnf111 UTSW 9 70476391 missense probably benign
R2762:Rnf111 UTSW 9 70476045 missense possibly damaging 0.82
R3980:Rnf111 UTSW 9 70442325 missense probably damaging 1.00
R4577:Rnf111 UTSW 9 70429584 nonsense probably null
R4631:Rnf111 UTSW 9 70450396 missense probably benign 0.07
R4804:Rnf111 UTSW 9 70430957 missense possibly damaging 0.70
R5153:Rnf111 UTSW 9 70476140 missense probably benign 0.35
R5500:Rnf111 UTSW 9 70476043 missense possibly damaging 0.94
R5546:Rnf111 UTSW 9 70459096 missense probably benign 0.05
R5975:Rnf111 UTSW 9 70429580 missense probably damaging 1.00
R6395:Rnf111 UTSW 9 70476410 missense possibly damaging 0.95
R6482:Rnf111 UTSW 9 70429607 missense probably damaging 1.00
R7056:Rnf111 UTSW 9 70453675 missense possibly damaging 0.60
R7239:Rnf111 UTSW 9 70469373 missense probably damaging 1.00
R7444:Rnf111 UTSW 9 70440843 missense probably damaging 1.00
R7618:Rnf111 UTSW 9 70503332 start gained probably benign
R8068:Rnf111 UTSW 9 70457941 missense not run
Predicted Primers PCR Primer
(F):5'- GGCCATGCTGCTGAAAACAACTTG -3'
(R):5'- GCCAGATACTCATTGAGGTGGATGC -3'

Sequencing Primer
(F):5'- GAGTGTGGGTGTGCTAATGC -3'
(R):5'- TGTGTTAAGCACATGGCACC -3'
Posted On2014-02-18