Incidental Mutation 'R1327:Zfp318'
ID157260
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission 039393-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1327 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46413263 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2064 (E2064G)
Ref Sequence ENSEMBL: ENSMUSP00000109109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect probably damaging
Transcript: ENSMUST00000113481
AA Change: E2064G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: E2064G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136017
Predicted Effect probably benign
Transcript: ENSMUST00000138127
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Meta Mutation Damage Score 0.0930 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 88.1%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,733,183 F99L possibly damaging Het
Arg1 T C 10: 24,920,804 probably null Het
Bsnd C T 4: 106,486,612 E166K probably benign Het
Cxcl9 A G 5: 92,326,850 C30R probably damaging Het
Cyhr1 T A 15: 76,649,176 T121S probably damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Epha5 C A 5: 84,106,785 D632Y probably damaging Het
Fbxw11 T C 11: 32,711,859 Y79H probably benign Het
Fh1 A G 1: 175,609,744 M263T probably benign Het
Gm14124 A T 2: 150,266,150 H10L possibly damaging Het
Mrgprb1 A T 7: 48,447,429 I245N possibly damaging Het
Ms4a13 A T 19: 11,183,887 I96N probably damaging Het
Nipa2 G A 7: 55,944,508 L38F possibly damaging Het
Pappa T A 4: 65,351,603 probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf111 A T 9: 70,453,816 D454E possibly damaging Het
Rp1 C T 1: 4,347,970 G973D probably benign Het
Rtn3 A G 19: 7,431,011 V922A possibly damaging Het
Setbp1 T C 18: 78,783,358 M1347V probably benign Het
Slc6a6 A G 6: 91,726,035 I130V probably benign Het
Smad7 T C 18: 75,375,945 S48P probably benign Het
Star A G 8: 25,809,837 D69G probably benign Het
Syne1 C A 10: 5,048,925 probably benign Het
Synj1 A T 16: 90,946,855 N1212K probably benign Het
Tep1 T C 14: 50,853,099 M721V probably benign Het
Txndc11 T C 16: 11,116,814 D223G possibly damaging Het
Vit G A 17: 78,625,200 D579N probably damaging Het
Zan T C 5: 137,465,911 probably benign Het
Zic5 T G 14: 122,459,779 probably benign Het
Zzef1 T C 11: 72,893,414 probably null Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 intron probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6980:Zfp318 UTSW 17 46397212 missense probably damaging 1.00
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
R7426:Zfp318 UTSW 17 46400069 missense probably damaging 1.00
R7600:Zfp318 UTSW 17 46384284 missense possibly damaging 0.86
R7608:Zfp318 UTSW 17 46400009 missense probably damaging 0.96
R7779:Zfp318 UTSW 17 46399894 missense probably benign 0.16
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAACTGCCCTGTCAGAGAAAATG -3'
(R):5'- CAGGTGTCCGTGTGACAAAATCAAC -3'

Sequencing Primer
(F):5'- CCCTGTCAGAGAAAATGTCTGAAG -3'
(R):5'- TGTGACAAAATCAACAAGGTCTG -3'
Posted On2014-02-18