Incidental Mutation 'R1328:Sag'
ID 157265
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene Name S-antigen, retina and pineal gland (arrestin)
Synonyms arrestin 1, rod arrestin, Arr1, visual arrestin 1, A930001K18Rik
MMRRC Submission 039394-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1328 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 87731402-87772880 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 87738016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
AlphaFold P20443
Predicted Effect probably benign
Transcript: ENSMUST00000077772
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156381
Predicted Effect probably benign
Transcript: ENSMUST00000177757
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 C T 7: 43,906,516 (GRCm39) probably null Het
Bcap29 T C 12: 31,680,807 (GRCm39) I60V probably benign Het
Ccdc71 T A 9: 108,340,148 (GRCm39) probably benign Het
Ccnb1ip1 A T 14: 51,027,382 (GRCm39) V240E probably benign Het
Copa C T 1: 171,949,258 (GRCm39) probably benign Het
Dmxl2 G T 9: 54,303,533 (GRCm39) Q2314K probably benign Het
Fam181b T C 7: 92,729,437 (GRCm39) I70T probably damaging Het
Fbxl14 T C 6: 119,457,347 (GRCm39) L176P possibly damaging Het
Fip1l1 T A 5: 74,706,796 (GRCm39) F144L possibly damaging Het
Flnc T C 6: 29,438,612 (GRCm39) W169R probably damaging Het
H2-M3 T C 17: 37,581,925 (GRCm39) V127A possibly damaging Het
Il23r T A 6: 67,468,802 (GRCm39) probably benign Het
Krt18 C T 15: 101,939,169 (GRCm39) A251V probably benign Het
Mast1 A G 8: 85,644,617 (GRCm39) probably benign Het
Or6c202 A G 10: 128,996,293 (GRCm39) S187P possibly damaging Het
Or9i14 G A 19: 13,792,900 (GRCm39) T18I probably benign Het
Pkhd1l1 T C 15: 44,361,392 (GRCm39) Y481H probably benign Het
Polr3e C T 7: 120,533,046 (GRCm39) probably benign Het
Pou4f2 G A 8: 79,162,759 (GRCm39) A92V probably benign Het
Pramel5 A G 4: 143,998,058 (GRCm39) L395P probably damaging Het
Prmt9 T C 8: 78,299,283 (GRCm39) I659T possibly damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rrp36 T A 17: 46,983,705 (GRCm39) K36* probably null Het
Setd7 T C 3: 51,450,240 (GRCm39) Y62C possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Sox13 T C 1: 133,311,555 (GRCm39) D559G probably damaging Het
Srd5a1 T A 13: 69,723,310 (GRCm39) Y236F probably damaging Het
Stxbp2 A T 8: 3,692,657 (GRCm39) I570F possibly damaging Het
Tbc1d31 T C 15: 57,805,859 (GRCm39) probably benign Het
Trim33 A G 3: 103,260,913 (GRCm39) T1064A possibly damaging Het
Vmn1r8 T C 6: 57,013,278 (GRCm39) S110P possibly damaging Het
Vmn2r118 C A 17: 55,915,620 (GRCm39) M443I probably benign Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87,752,146 (GRCm39) critical splice acceptor site probably null
IGL00822:Sag APN 1 87,772,748 (GRCm39) splice site probably null
IGL01140:Sag APN 1 87,751,086 (GRCm39) missense probably benign 0.22
IGL01612:Sag APN 1 87,733,071 (GRCm39) missense probably damaging 0.98
IGL02183:Sag APN 1 87,756,197 (GRCm39) splice site probably null
IGL02893:Sag APN 1 87,762,315 (GRCm39) missense probably benign 0.01
R0049:Sag UTSW 1 87,762,340 (GRCm39) missense probably damaging 0.99
R0049:Sag UTSW 1 87,762,340 (GRCm39) missense probably damaging 0.99
R0091:Sag UTSW 1 87,742,402 (GRCm39) missense probably damaging 0.96
R0531:Sag UTSW 1 87,762,351 (GRCm39) critical splice donor site probably null
R0609:Sag UTSW 1 87,740,713 (GRCm39) missense probably damaging 0.98
R1395:Sag UTSW 1 87,756,163 (GRCm39) missense probably benign 0.01
R1748:Sag UTSW 1 87,759,662 (GRCm39) missense probably damaging 1.00
R1858:Sag UTSW 1 87,742,570 (GRCm39) missense probably benign
R2020:Sag UTSW 1 87,733,037 (GRCm39) missense probably damaging 1.00
R3854:Sag UTSW 1 87,752,240 (GRCm39) splice site probably benign
R4021:Sag UTSW 1 87,749,027 (GRCm39) critical splice acceptor site probably null
R4298:Sag UTSW 1 87,772,737 (GRCm39) missense probably benign
R4630:Sag UTSW 1 87,762,340 (GRCm39) missense probably damaging 0.99
R5352:Sag UTSW 1 87,740,715 (GRCm39) missense probably benign 0.01
R5680:Sag UTSW 1 87,749,059 (GRCm39) missense possibly damaging 0.83
R6164:Sag UTSW 1 87,752,175 (GRCm39) missense probably damaging 1.00
R6407:Sag UTSW 1 87,742,528 (GRCm39) missense probably benign
R7431:Sag UTSW 1 87,749,059 (GRCm39) missense possibly damaging 0.83
R7548:Sag UTSW 1 87,772,638 (GRCm39) missense probably benign 0.01
R8122:Sag UTSW 1 87,762,289 (GRCm39) missense probably damaging 1.00
R8679:Sag UTSW 1 87,738,032 (GRCm39) missense probably benign 0.27
R8723:Sag UTSW 1 87,751,175 (GRCm39) critical splice donor site probably null
R8878:Sag UTSW 1 87,756,158 (GRCm39) missense probably benign 0.01
R8891:Sag UTSW 1 87,759,683 (GRCm39) missense probably damaging 1.00
R8995:Sag UTSW 1 87,733,052 (GRCm39) missense probably benign 0.00
R9036:Sag UTSW 1 87,749,054 (GRCm39) missense probably damaging 1.00
R9123:Sag UTSW 1 87,751,043 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGAATTCCTTGGAGCCCACGTA -3'
(R):5'- tggatcaccatcccctactGGCAT -3'

Sequencing Primer
(F):5'- GGACACTGTACTTGAAATGAACC -3'
(R):5'- GCAGTCTGATGACTGAGAGGAA -3'
Posted On 2014-02-18