Incidental Mutation 'R1328:Setd7'
ID157269
Institutional Source Beutler Lab
Gene Symbol Setd7
Ensembl Gene ENSMUSG00000037111
Gene NameSET domain containing (lysine methyltransferase) 7
SynonymsKMT7, Set7, 1600028F23Rik, Set7/9
MMRRC Submission 039394-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1328 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51515319-51560879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51542819 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 62 (Y62C)
Ref Sequence ENSEMBL: ENSMUSP00000043492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037141
AA Change: Y62C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043492
Gene: ENSMUSG00000037111
AA Change: Y62C

DomainStartEndE-ValueType
Pfam:MORN 13 35 9e-3 PFAM
Pfam:MORN 36 58 1.7e-6 PFAM
Pfam:MORN 60 81 1.6e-6 PFAM
Pfam:MORN 106 128 2.2e-6 PFAM
SET 214 342 2.35e-2 SMART
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele exhibit partial prenatal lethality and failure of mouse embryonic fibroblasts and spleen cells to arrest after doxorubicin treatment. Homozygotes for a different knock-out allele show resistance to bleomycin- or adenovirus-TGFbeta-induced pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 C T 7: 44,257,092 probably null Het
Bcap29 T C 12: 31,630,808 I60V probably benign Het
Ccdc71 T A 9: 108,462,949 probably benign Het
Ccnb1ip1 A T 14: 50,789,925 V240E probably benign Het
Copa C T 1: 172,121,691 probably benign Het
Dmxl2 G T 9: 54,396,249 Q2314K probably benign Het
Fam181b T C 7: 93,080,229 I70T probably damaging Het
Fbxl14 T C 6: 119,480,386 L176P possibly damaging Het
Fip1l1 T A 5: 74,546,135 F144L possibly damaging Het
Flnc T C 6: 29,438,613 W169R probably damaging Het
H2-M3 T C 17: 37,271,034 V127A possibly damaging Het
Il23r T A 6: 67,491,818 probably benign Het
Krt18 C T 15: 102,030,734 A251V probably benign Het
Mast1 A G 8: 84,917,988 probably benign Het
Olfr1499 G A 19: 13,815,536 T18I probably benign Het
Olfr771 A G 10: 129,160,424 S187P possibly damaging Het
Pkhd1l1 T C 15: 44,497,996 Y481H probably benign Het
Polr3e C T 7: 120,933,823 probably benign Het
Pou4f2 G A 8: 78,436,130 A92V probably benign Het
Pramel5 A G 4: 144,271,488 L395P probably damaging Het
Prmt9 T C 8: 77,572,654 I659T possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rrp36 T A 17: 46,672,779 K36* probably null Het
Sag G A 1: 87,810,294 probably benign Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Sox13 T C 1: 133,383,817 D559G probably damaging Het
Srd5a1 T A 13: 69,575,191 Y236F probably damaging Het
Stxbp2 A T 8: 3,642,657 I570F possibly damaging Het
Tbc1d31 T C 15: 57,942,463 probably benign Het
Trim33 A G 3: 103,353,597 T1064A possibly damaging Het
Vmn1r8 T C 6: 57,036,293 S110P possibly damaging Het
Vmn2r118 C A 17: 55,608,620 M443I probably benign Het
Other mutations in Setd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Setd7 APN 3 51550308 missense probably benign 0.00
IGL00940:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00943:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00944:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL01466:Setd7 APN 3 51521309 makesense probably null
IGL01810:Setd7 APN 3 51532967 splice site probably benign
IGL01884:Setd7 APN 3 51542711 missense possibly damaging 0.71
IGL02117:Setd7 APN 3 51521405 missense probably damaging 1.00
IGL02806:Setd7 APN 3 51550267 missense probably damaging 0.97
IGL03258:Setd7 APN 3 51560515 splice site probably null
IGL03404:Setd7 APN 3 51532986 nonsense probably null
R0366:Setd7 UTSW 3 51550320 missense probably benign 0.07
R1819:Setd7 UTSW 3 51542639 missense probably benign 0.38
R1872:Setd7 UTSW 3 51542831 missense probably benign 0.29
R2406:Setd7 UTSW 3 51542676 missense probably damaging 0.99
R2513:Setd7 UTSW 3 51533015 missense probably damaging 1.00
R4231:Setd7 UTSW 3 51542730 missense probably benign 0.24
R4627:Setd7 UTSW 3 51542665 missense probably damaging 0.99
R4687:Setd7 UTSW 3 51550355 missense probably damaging 1.00
R4770:Setd7 UTSW 3 51521422 missense probably damaging 1.00
R5212:Setd7 UTSW 3 51542817 missense probably damaging 1.00
R5472:Setd7 UTSW 3 51521465 missense probably benign 0.00
R6127:Setd7 UTSW 3 51530081 missense probably damaging 1.00
R6647:Setd7 UTSW 3 51542762 missense probably benign 0.00
R6966:Setd7 UTSW 3 51530184 missense probably damaging 1.00
R7744:Setd7 UTSW 3 51526840 splice site probably null
R7828:Setd7 UTSW 3 51536657 critical splice acceptor site probably null
R7896:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
R7979:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
X0022:Setd7 UTSW 3 51542652 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGGTAGCAGCTTACCGGGTAATG -3'
(R):5'- GGTTGAAACAGAGCTGAGCCTGTG -3'

Sequencing Primer
(F):5'- CACTCCGTGTCGATTGTTGT -3'
(R):5'- gccaccaagcctgacaac -3'
Posted On2014-02-18