Mutagenetix > Incidental Mutation

Incidental Mutation 'R1328:Vmn2r118'

157294

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

039394-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R1328 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 55608620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 443 (M443I)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

probably benign
Transcript: ENSMUST00000168440
AA Change: M443I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: M443I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.9%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp4	C	T	7: 44,257,092		probably null	Het
Bcap29	T	C	12: 31,630,808	I60V	probably benign	Het
Ccdc71	T	A	9: 108,462,949		probably benign	Het
Ccnb1ip1	A	T	14: 50,789,925	V240E	probably benign	Het
Copa	C	T	1: 172,121,691		probably benign	Het
Dmxl2	G	T	9: 54,396,249	Q2314K	probably benign	Het
Fam181b	T	C	7: 93,080,229	I70T	probably damaging	Het
Fbxl14	T	C	6: 119,480,386	L176P	possibly damaging	Het
Fip1l1	T	A	5: 74,546,135	F144L	possibly damaging	Het
Flnc	T	C	6: 29,438,613	W169R	probably damaging	Het
H2-M3	T	C	17: 37,271,034	V127A	possibly damaging	Het
Il23r	T	A	6: 67,491,818		probably benign	Het
Krt18	C	T	15: 102,030,734	A251V	probably benign	Het
Mast1	A	G	8: 84,917,988		probably benign	Het
Olfr1499	G	A	19: 13,815,536	T18I	probably benign	Het
Olfr771	A	G	10: 129,160,424	S187P	possibly damaging	Het
Pkhd1l1	T	C	15: 44,497,996	Y481H	probably benign	Het
Polr3e	C	T	7: 120,933,823		probably benign	Het
Pou4f2	G	A	8: 78,436,130	A92V	probably benign	Het
Pramel5	A	G	4: 144,271,488	L395P	probably damaging	Het
Prmt9	T	C	8: 77,572,654	I659T	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rrp36	T	A	17: 46,672,779	K36*	probably null	Het
Sag	G	A	1: 87,810,294		probably benign	Het
Setd7	T	C	3: 51,542,819	Y62C	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Sox13	T	C	1: 133,383,817	D559G	probably damaging	Het
Srd5a1	T	A	13: 69,575,191	Y236F	probably damaging	Het
Stxbp2	A	T	8: 3,642,657	I570F	possibly damaging	Het
Tbc1d31	T	C	15: 57,942,463		probably benign	Het
Trim33	A	G	3: 103,353,597	T1064A	possibly damaging	Het
Vmn1r8	T	C	6: 57,036,293	S110P	possibly damaging	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
R8917:Vmn2r118	UTSW	17	55610216	missense	possibly damaging	0.82
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9038:Vmn2r118	UTSW	17	55611649	missense	probably damaging	1.00
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9742:Vmn2r118	UTSW	17	55611009	missense	probably damaging	0.98
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACAGCTCACACTGCATACAGAAGG -3'
(R):5'- cacagctcAGCATGTAAAAGAAGGCTAA -3'

Sequencing Primer
(F):5'- AGGCCCATTGGATCATGTC -3'
(R):5'- GGCTAATTTGATCTACTCTTATCTCC -3'

Posted On

2014-02-18