Incidental Mutation 'R1328:Olfr1499'
ID157295
Institutional Source Beutler Lab
Gene Symbol Olfr1499
Ensembl Gene ENSMUSG00000045395
Gene Nameolfactory receptor 1499
SynonymsMOR211-2, GA_x6K02T2RE5P-4147744-4146800
MMRRC Submission 039394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1328 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13814275-13819447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13815536 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 18 (T18I)
Ref Sequence ENSEMBL: ENSMUSP00000150330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055672] [ENSMUST00000216659]
Predicted Effect probably benign
Transcript: ENSMUST00000055672
AA Change: T18I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059747
Gene: ENSMUSG00000045395
AA Change: T18I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-44 PFAM
Pfam:7tm_1 41 290 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216659
AA Change: T18I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 C T 7: 44,257,092 probably null Het
Bcap29 T C 12: 31,630,808 I60V probably benign Het
Ccdc71 T A 9: 108,462,949 probably benign Het
Ccnb1ip1 A T 14: 50,789,925 V240E probably benign Het
Copa C T 1: 172,121,691 probably benign Het
Dmxl2 G T 9: 54,396,249 Q2314K probably benign Het
Fam181b T C 7: 93,080,229 I70T probably damaging Het
Fbxl14 T C 6: 119,480,386 L176P possibly damaging Het
Fip1l1 T A 5: 74,546,135 F144L possibly damaging Het
Flnc T C 6: 29,438,613 W169R probably damaging Het
H2-M3 T C 17: 37,271,034 V127A possibly damaging Het
Il23r T A 6: 67,491,818 probably benign Het
Krt18 C T 15: 102,030,734 A251V probably benign Het
Mast1 A G 8: 84,917,988 probably benign Het
Olfr771 A G 10: 129,160,424 S187P possibly damaging Het
Pkhd1l1 T C 15: 44,497,996 Y481H probably benign Het
Polr3e C T 7: 120,933,823 probably benign Het
Pou4f2 G A 8: 78,436,130 A92V probably benign Het
Pramel5 A G 4: 144,271,488 L395P probably damaging Het
Prmt9 T C 8: 77,572,654 I659T possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rrp36 T A 17: 46,672,779 K36* probably null Het
Sag G A 1: 87,810,294 probably benign Het
Setd7 T C 3: 51,542,819 Y62C possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Sox13 T C 1: 133,383,817 D559G probably damaging Het
Srd5a1 T A 13: 69,575,191 Y236F probably damaging Het
Stxbp2 A T 8: 3,642,657 I570F possibly damaging Het
Tbc1d31 T C 15: 57,942,463 probably benign Het
Trim33 A G 3: 103,353,597 T1064A possibly damaging Het
Vmn1r8 T C 6: 57,036,293 S110P possibly damaging Het
Vmn2r118 C A 17: 55,608,620 M443I probably benign Het
Other mutations in Olfr1499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1499 APN 19 13815302 missense probably benign 0.09
IGL01844:Olfr1499 APN 19 13814816 missense possibly damaging 0.95
IGL03102:Olfr1499 APN 19 13815371 missense probably damaging 1.00
IGL03352:Olfr1499 APN 19 13814928 missense probably damaging 1.00
R0218:Olfr1499 UTSW 19 13814978 missense probably benign 0.19
R0490:Olfr1499 UTSW 19 13814855 missense probably damaging 1.00
R0682:Olfr1499 UTSW 19 13815137 missense possibly damaging 0.94
R1301:Olfr1499 UTSW 19 13815362 missense probably damaging 1.00
R2100:Olfr1499 UTSW 19 13815236 missense possibly damaging 0.95
R3701:Olfr1499 UTSW 19 13815348 missense probably benign 0.03
R4563:Olfr1499 UTSW 19 13815282 missense probably benign 0.01
R4709:Olfr1499 UTSW 19 13815450 missense possibly damaging 0.94
R5231:Olfr1499 UTSW 19 13815347 missense probably damaging 0.99
R5301:Olfr1499 UTSW 19 13815569 missense probably damaging 0.99
R5343:Olfr1499 UTSW 19 13814960 missense probably damaging 1.00
R6268:Olfr1499 UTSW 19 13815307 nonsense probably null
R6442:Olfr1499 UTSW 19 13815628 start gained probably benign
R7132:Olfr1499 UTSW 19 13815422 missense probably benign 0.09
R7764:Olfr1499 UTSW 19 13814747 missense probably benign 0.01
Z1088:Olfr1499 UTSW 19 13815548 missense probably damaging 1.00
Z1177:Olfr1499 UTSW 19 13815044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGCAGGCATCCAACACAGAG -3'
(R):5'- TGCAAGCACAAAAGTGGCATCTTC -3'

Sequencing Primer
(F):5'- TCCAACACAGAGAGATGACTCAG -3'
(R):5'- TTCCCCAAACCTGAGGATTATC -3'
Posted On2014-02-18