Incidental Mutation 'R1371:Il1rl1'
ID157296
Institutional Source Beutler Lab
Gene Symbol Il1rl1
Ensembl Gene ENSMUSG00000026069
Gene Nameinterleukin 1 receptor-like 1
SynonymsT1 gene, St2-rs1, ST2, T1, T1/ST2, Ly84, Fit-1, DER4, St2, ST2L
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40429570-40465415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40442713 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 194 (N194D)
Ref Sequence ENSEMBL: ENSMUSP00000134351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053043] [ENSMUST00000097772] [ENSMUST00000173514] [ENSMUST00000173881] [ENSMUST00000174335]
Predicted Effect probably damaging
Transcript: ENSMUST00000053043
AA Change: N194D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054914
Gene: ENSMUSG00000026069
AA Change: N194D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097772
AA Change: N194D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095379
Gene: ENSMUSG00000026069
AA Change: N194D

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
transmembrane domain 333 355 N/A INTRINSIC
TIR 381 543 4.23e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173514
AA Change: N194D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133784
Gene: ENSMUSG00000026069
AA Change: N194D

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173881
SMART Domains Protein: ENSMUSP00000134225
Gene: ENSMUSG00000026069

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:4KC3|B 27 65 4e-16 PDB
Blast:IGc2 33 65 2e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174335
AA Change: N194D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134351
Gene: ENSMUSG00000026069
AA Change: N194D

DomainStartEndE-ValueType
IGc2 33 100 7.35e-11 SMART
IGc2 130 194 8.85e-5 SMART
IG_like 225 326 2.66e1 SMART
Meta Mutation Damage Score 0.1908 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal Th2 type inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Il1rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Il1rl1 APN 1 40446216 missense possibly damaging 0.75
IGL01413:Il1rl1 APN 1 40446169 missense possibly damaging 0.85
IGL01939:Il1rl1 APN 1 40462008 missense possibly damaging 0.80
IGL02121:Il1rl1 APN 1 40442303 splice site probably benign
IGL02160:Il1rl1 APN 1 40461837 missense probably benign 0.00
IGL02695:Il1rl1 APN 1 40446558 missense possibly damaging 0.47
R0007:Il1rl1 UTSW 1 40446171 missense possibly damaging 0.95
R0105:Il1rl1 UTSW 1 40442574 splice site probably benign
R0200:Il1rl1 UTSW 1 40441303 missense possibly damaging 0.95
R0363:Il1rl1 UTSW 1 40442574 splice site probably benign
R0508:Il1rl1 UTSW 1 40451717 missense possibly damaging 0.87
R0637:Il1rl1 UTSW 1 40442574 splice site probably benign
R0676:Il1rl1 UTSW 1 40442574 splice site probably benign
R2074:Il1rl1 UTSW 1 40462044 missense probably damaging 0.99
R2309:Il1rl1 UTSW 1 40442657 missense possibly damaging 0.46
R2426:Il1rl1 UTSW 1 40446619 missense probably damaging 1.00
R3983:Il1rl1 UTSW 1 40446663 missense possibly damaging 0.73
R4601:Il1rl1 UTSW 1 40441300 missense possibly damaging 0.88
R4707:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R4720:Il1rl1 UTSW 1 40446678 missense probably benign 0.24
R4784:Il1rl1 UTSW 1 40450188 missense probably damaging 0.96
R5137:Il1rl1 UTSW 1 40450125 missense probably benign
R5765:Il1rl1 UTSW 1 40461943 missense probably benign 0.06
R5953:Il1rl1 UTSW 1 40442673 missense probably benign 0.05
R6339:Il1rl1 UTSW 1 40461856 missense possibly damaging 0.88
R7176:Il1rl1 UTSW 1 40446606 missense probably damaging 1.00
R7677:Il1rl1 UTSW 1 40446704 makesense probably null
R8129:Il1rl1 UTSW 1 40451827 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCTGCACAAGTGATGTAGCTGAGAG -3'
(R):5'- AAACCTATGCTTCATGGCAACTTCCT -3'

Sequencing Primer
(F):5'- TGATGTAGCTGAGAGTGAAAATTG -3'
(R):5'- GGCAACTTCCTTTCATGTTAGAG -3'
Posted On2014-02-18