Incidental Mutation 'R1371:Ccdc181'
ID157298
Institutional Source Beutler Lab
Gene Symbol Ccdc181
Ensembl Gene ENSMUSG00000026578
Gene Namecoiled-coil domain containing 181
Synonyms4930455F23Rik
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164275585-164287847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164280603 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 285 (E285G)
Ref Sequence ENSEMBL: ENSMUSP00000027867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027867]
Predicted Effect probably benign
Transcript: ENSMUST00000027867
AA Change: E285G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027867
Gene: ENSMUSG00000026578
AA Change: E285G

DomainStartEndE-ValueType
low complexity region 116 122 N/A INTRINSIC
coiled coil region 334 378 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Ccdc181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ccdc181 APN 1 164280144 missense possibly damaging 0.75
IGL02634:Ccdc181 APN 1 164279945 missense probably benign 0.00
IGL02902:Ccdc181 APN 1 164279901 missense probably benign
IGL03201:Ccdc181 APN 1 164280644 missense probably benign 0.13
R1228:Ccdc181 UTSW 1 164286391 nonsense probably null
R1819:Ccdc181 UTSW 1 164282478 nonsense probably null
R2240:Ccdc181 UTSW 1 164280027 missense probably damaging 1.00
R3160:Ccdc181 UTSW 1 164280296 missense probably damaging 0.97
R3162:Ccdc181 UTSW 1 164280296 missense probably damaging 0.97
R4678:Ccdc181 UTSW 1 164278277 missense probably damaging 1.00
R5286:Ccdc181 UTSW 1 164278241 missense probably damaging 1.00
R6179:Ccdc181 UTSW 1 164279918 missense probably benign 0.21
R6886:Ccdc181 UTSW 1 164280096 missense probably damaging 0.96
R7517:Ccdc181 UTSW 1 164280420 missense probably damaging 1.00
R7528:Ccdc181 UTSW 1 164279958 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGCTTCTTCAGACTCAAGAGCC -3'
(R):5'- TGAAATGCACTCTTCTTCCCACACG -3'

Sequencing Primer
(F):5'- TGATCTGGAAGTCCCACCATTAG -3'
(R):5'- TGAGCTTTTCACGCTTTCG -3'
Posted On2014-02-18