Incidental Mutation 'R1371:Acvr2a'
ID157301
Institutional Source Beutler Lab
Gene Symbol Acvr2a
Ensembl Gene ENSMUSG00000052155
Gene Nameactivin receptor IIA
SynonymsActRIIa, Acvr2, tActRII
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48814109-48903269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48899616 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 457 (T457M)
Ref Sequence ENSEMBL: ENSMUSP00000067305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000063886]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF THE TYPE II ACTIVIN RECEPTOR [X-RAY DIFFRACTION]
Crystal Structure of the BMP7/ActRII Extracellular Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028098
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063886
AA Change: T457M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067305
Gene: ENSMUSG00000052155
AA Change: T457M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Activin_recp 28 118 5e-10 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Pkinase_Tyr 192 479 1.2e-31 PFAM
Pfam:Pkinase 196 481 7.6e-34 PFAM
low complexity region 486 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156681
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that mediates the functions of activins, which are members of the transforming growth factor-beta (TGF-beta) superfamily involved in diverse biological processes. The encoded protein is a transmembrane serine-threonine kinase receptor which mediates signaling by forming heterodimeric complexes with various combinations of type I and type II receptors and ligands in a cell-specific manner. The encoded type II receptor is primarily involved in ligand-binding and includes an extracellular ligand-binding domain, a transmembrane domain and a cytoplasmic serine-threonine kinase domain. This gene may be associated with susceptibility to preeclampsia, a pregnancy-related disease which can result in maternal and fetal morbidity and mortality. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: While most mice homozygous for targeted mutations that inactivate this gene appear normal, a few display skeletal and facial abnormalities. As adults, follicle-stimulating hormone is suppressed, affecting reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Acvr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Acvr2a APN 2 48873052 splice site probably benign
IGL01551:Acvr2a APN 2 48897059 missense probably damaging 1.00
IGL01913:Acvr2a APN 2 48899613 missense probably damaging 1.00
IGL02100:Acvr2a APN 2 48898618 splice site probably benign
IGL02210:Acvr2a APN 2 48898526 missense probably damaging 0.99
R0864:Acvr2a UTSW 2 48894786 splice site probably benign
R1676:Acvr2a UTSW 2 48873083 missense probably benign 0.00
R2196:Acvr2a UTSW 2 48870312 missense possibly damaging 0.94
R2876:Acvr2a UTSW 2 48892178 missense probably damaging 1.00
R3721:Acvr2a UTSW 2 48892138 missense probably damaging 1.00
R3763:Acvr2a UTSW 2 48870319 missense possibly damaging 0.87
R4401:Acvr2a UTSW 2 48899702 missense probably benign
R4724:Acvr2a UTSW 2 48870435 missense probably damaging 1.00
R4921:Acvr2a UTSW 2 48893541 missense possibly damaging 0.51
R5060:Acvr2a UTSW 2 48890299 missense probably damaging 0.96
R5347:Acvr2a UTSW 2 48892154 missense probably damaging 1.00
R5953:Acvr2a UTSW 2 48890404 missense probably damaging 1.00
R6892:Acvr2a UTSW 2 48897075 missense probably damaging 1.00
R7594:Acvr2a UTSW 2 48894737 nonsense probably null
R7876:Acvr2a UTSW 2 48870427 missense probably benign 0.01
R8123:Acvr2a UTSW 2 48873372 missense probably damaging 0.99
R8296:Acvr2a UTSW 2 48899724 missense possibly damaging 0.95
Z1088:Acvr2a UTSW 2 48870373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACTCACATGCAGAGGCAGAAAG -3'
(R):5'- TTAGCAGCTCCAGTTCAGAGTCCC -3'

Sequencing Primer
(F):5'- GCTGGCTTGCATAATACACC -3'
(R):5'- AGTTCAGAGTCCCAGTCCTCAG -3'
Posted On2014-02-18