Incidental Mutation 'R1371:Sall4'
ID157302
Institutional Source Beutler Lab
Gene Symbol Sall4
Ensembl Gene ENSMUSG00000027547
Gene Namespalt like transcription factor 4
Synonyms5730441M18Rik, Tex20, C330011P20Rik
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168748332-168767943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168756474 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 149 (Y149H)
Ref Sequence ENSEMBL: ENSMUSP00000099363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029061] [ENSMUST00000075044] [ENSMUST00000103074] [ENSMUST00000137536] [ENSMUST00000150588]
Predicted Effect probably benign
Transcript: ENSMUST00000029061
AA Change: Y149H

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029061
Gene: ENSMUSG00000027547
AA Change: Y149H

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
ZnF_C2H2 387 409 1.04e-3 SMART
ZnF_C2H2 415 437 2.15e-5 SMART
ZnF_C2H2 573 595 5.34e0 SMART
ZnF_C2H2 601 623 1.22e-4 SMART
ZnF_C2H2 633 655 1.84e-4 SMART
low complexity region 855 867 N/A INTRINSIC
ZnF_C2H2 880 902 2.53e-2 SMART
ZnF_C2H2 908 930 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075044
SMART Domains Protein: ENSMUSP00000074556
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 30 38 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
ZnF_C2H2 91 113 2.53e-2 SMART
ZnF_C2H2 119 141 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103074
AA Change: Y149H

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099363
Gene: ENSMUSG00000027547
AA Change: Y149H

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 436 458 2.53e-2 SMART
ZnF_C2H2 464 486 1.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130640
Predicted Effect probably benign
Transcript: ENSMUST00000137536
AA Change: Y118H

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115646
Gene: ENSMUSG00000027547
AA Change: Y118H

DomainStartEndE-ValueType
Blast:ZnF_C2H2 37 61 6e-9 BLAST
low complexity region 162 172 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150588
SMART Domains Protein: ENSMUSP00000119628
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
ZnF_C2H2 64 86 1.22e-4 SMART
ZnF_C2H2 96 118 1.84e-4 SMART
Meta Mutation Damage Score 0.0734 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality before somite formation. Heterozygous mutation of this locus causes variable phenotypes, from heart and digit defects to deafness, anogenital tract defects, cranial and carpal bone defects and renal agenesis or hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Sall4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Sall4 APN 2 168755312 missense probably benign 0.02
IGL00592:Sall4 APN 2 168755963 missense probably damaging 1.00
IGL00674:Sall4 APN 2 168755780 missense probably damaging 0.99
IGL01308:Sall4 APN 2 168750244 missense probably damaging 0.99
IGL01538:Sall4 APN 2 168755856 missense probably damaging 1.00
IGL01552:Sall4 APN 2 168756123 missense probably damaging 1.00
IGL02614:Sall4 APN 2 168755885 missense probably null 0.79
R0514:Sall4 UTSW 2 168755705 missense probably damaging 1.00
R0531:Sall4 UTSW 2 168756336 missense probably benign 0.10
R0747:Sall4 UTSW 2 168754966 missense probably damaging 1.00
R1736:Sall4 UTSW 2 168752635 missense probably benign 0.10
R2067:Sall4 UTSW 2 168756545 missense probably benign 0.00
R3766:Sall4 UTSW 2 168756044 missense possibly damaging 0.93
R3783:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3784:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3785:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3787:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3877:Sall4 UTSW 2 168756242 missense probably damaging 1.00
R4356:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4358:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4760:Sall4 UTSW 2 168750427 missense probably damaging 0.98
R4869:Sall4 UTSW 2 168755717 missense probably damaging 1.00
R5979:Sall4 UTSW 2 168750343 missense probably benign 0.28
R6089:Sall4 UTSW 2 168755486 missense possibly damaging 0.92
R6502:Sall4 UTSW 2 168755708 missense probably damaging 1.00
R6990:Sall4 UTSW 2 168755070 missense probably damaging 1.00
R7999:Sall4 UTSW 2 168752641 missense probably damaging 0.99
R8436:Sall4 UTSW 2 168755910 missense probably damaging 1.00
Z1177:Sall4 UTSW 2 168752575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCGAATCTGTTCCGTAAGCTG -3'
(R):5'- AAGTTGCACTAAAACCCCTCCTGTC -3'

Sequencing Primer
(F):5'- ACAGGATCTGCTCCAGGAC -3'
(R):5'- TGTCCTCATCATGAATGACAGC -3'
Posted On2014-02-18