Incidental Mutation 'R1371:Zbbx'
ID157304
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75052477 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 595 (Y595C)
Ref Sequence ENSEMBL: ENSMUSP00000103407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: Y590C

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: Y590C

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: Y595C

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: Y595C

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Meta Mutation Damage Score 0.1181 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R8110:Zbbx UTSW 3 75155442 missense possibly damaging 0.58
R8367:Zbbx UTSW 3 75081727 critical splice donor site probably null
Z1177:Zbbx UTSW 3 75071783 critical splice acceptor site probably null
Z1177:Zbbx UTSW 3 75105684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACCAGTACATACATGAGGATGTCAGA -3'
(R):5'- TGTAGGCCAGAAATCACAGAGACCA -3'

Sequencing Primer
(F):5'- ggggggggggtagtcag -3'
(R):5'- CCATCAACAGCAAATATTCCTATTTC -3'
Posted On2014-02-18