Incidental Mutation 'R1371:F3'
ID157306
Institutional Source Beutler Lab
Gene Symbol F3
Ensembl Gene ENSMUSG00000028128
Gene Namecoagulation factor III
SynonymsTF, Cf3, tissue factor, Cf-3, CD142
MMRRC Submission 039435-MU
Accession Numbers

Genbank: NM_010171

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121723537-121735048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121732510 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 241 (C241R)
Ref Sequence ENSEMBL: ENSMUSP00000029771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029771
AA Change: C241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029771
Gene: ENSMUSG00000028128
AA Change: C241R

DomainStartEndE-ValueType
Pfam:Tissue_fac 12 110 1.1e-26 PFAM
Pfam:Interfer-bind 138 245 5.1e-26 PFAM
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197731
Predicted Effect probably benign
Transcript: ENSMUST00000199997
Meta Mutation Damage Score 0.9629 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired blood vessel development, retarded growth, and, in most cases, midgestational lethality. On a mixed background, some mutants survive to birth and appear to be normal. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Targeted, other(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in F3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:F3 APN 3 121731674 missense possibly damaging 0.83
G5030:F3 UTSW 3 121724999 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0622:F3 UTSW 3 121725019 missense probably damaging 1.00
R1367:F3 UTSW 3 121729374 missense probably damaging 0.98
R1925:F3 UTSW 3 121729383 missense probably damaging 1.00
R2100:F3 UTSW 3 121732433 missense possibly damaging 0.61
R2366:F3 UTSW 3 121732545 splice site probably null
R2471:F3 UTSW 3 121725040 missense probably damaging 1.00
R4577:F3 UTSW 3 121734114 missense probably benign 0.02
R5752:F3 UTSW 3 121732404 missense probably damaging 1.00
R6440:F3 UTSW 3 121725037 missense probably damaging 1.00
R6713:F3 UTSW 3 121731674 missense possibly damaging 0.83
R6845:F3 UTSW 3 121732475 missense probably benign 0.02
R6867:F3 UTSW 3 121729371 missense possibly damaging 0.93
R7145:F3 UTSW 3 121731586 missense probably damaging 1.00
R7511:F3 UTSW 3 121731557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTGCATGGACTTAGAGCCCTG -3'
(R):5'- CCTATAGAACCTGGCCCATTGCAAG -3'

Sequencing Primer
(F):5'- ACTTAGAGCCCTGGTTTTGC -3'
(R):5'- TGTGAAATCATTCCTAAATGCCCC -3'
Posted On2014-02-18