Incidental Mutation 'R1371:Ptger3'
ID157307
Institutional Source Beutler Lab
Gene Symbol Ptger3
Ensembl Gene ENSMUSG00000040016
Gene Nameprostaglandin E receptor 3 (subtype EP3)
SynonymsPtgerep3, Pgerep3, EP3
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1371 (G1)
Quality Score95
Status Validated
Chromosome3
Chromosomal Location157566892-157645888 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 157567728 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 237 (C237*)
Ref Sequence ENSEMBL: ENSMUSP00000134137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041175] [ENSMUST00000173533]
Predicted Effect probably null
Transcript: ENSMUST00000041175
AA Change: C237*
SMART Domains Protein: ENSMUSP00000043302
Gene: ENSMUSG00000040016
AA Change: C237*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srbc 25 171 6e-8 PFAM
Pfam:7tm_1 42 323 9.5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173533
AA Change: C237*
SMART Domains Protein: ENSMUSP00000134137
Gene: ENSMUSG00000040016
AA Change: C237*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srbc 25 171 4.1e-8 PFAM
Pfam:7tm_1 42 323 1.5e-23 PFAM
low complexity region 345 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196682
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased basal renal blood flow, decreased resting renal vascular resistance, impaired duodenal bicarbonate secretion and mucosal integrity, and impaired responses to endotoxin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Ptger3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02389:Ptger3 APN 3 157567171 missense probably damaging 1.00
R2437:Ptger3 UTSW 3 157567570 missense probably damaging 1.00
R4616:Ptger3 UTSW 3 157567294 missense probably damaging 1.00
R6526:Ptger3 UTSW 3 157567502 missense probably damaging 0.99
R7360:Ptger3 UTSW 3 157567127 missense probably benign 0.18
R7571:Ptger3 UTSW 3 157641775 missense probably benign 0.01
R8433:Ptger3 UTSW 3 157643955 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATGCCAGCCACATGAAGACTCG -3'
(R):5'- AGGGGCAAACATCAGTCTGCAC -3'

Sequencing Primer
(F):5'- ATGAAGACTCGCGCCACG -3'
(R):5'- GGACCGACTTGACTAGCTCTTG -3'
Posted On2014-02-18