Incidental Mutation 'R1371:Recql'
ID157311
Institutional Source Beutler Lab
Gene Symbol Recql
Ensembl Gene ENSMUSG00000030243
Gene NameRecQ protein-like
SynonymsRecQ1
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142350342-142387087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142372875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 214 (T214M)
Ref Sequence ENSEMBL: ENSMUSP00000107434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000100832] [ENSMUST00000111803] [ENSMUST00000128082] [ENSMUST00000129694] [ENSMUST00000203772]
Predicted Effect probably damaging
Transcript: ENSMUST00000032370
AA Change: T214M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243
AA Change: T214M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100832
AA Change: T214M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243
AA Change: T214M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111803
AA Change: T214M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243
AA Change: T214M

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128082
SMART Domains Protein: ENSMUSP00000120951
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Blast:DEXDc 24 84 4e-16 BLAST
PDB:2WWY|B 63 85 9e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129694
SMART Domains Protein: ENSMUSP00000122328
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
Pfam:DEAD 93 166 6.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155149
Predicted Effect probably benign
Transcript: ENSMUST00000203772
SMART Domains Protein: ENSMUSP00000145179
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
Pfam:DEAD 93 166 8.5e-12 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. The encoded protein is involved in the processing of Holliday junctions, the suppression of sister chromatid exchanges, telomere maintenance, and is required for genotoxic stress resistance. Defects in this gene have been associated with several types of cancer. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in chromosomal instability, with embryonic fibroblasts exhibiting aneuploidy, spontaneous chromosomal breakage, frequent translocation events, increased sensitivity to ionizing radiation, and increased frequency of sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Recql
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Recql APN 6 142376921 missense probably null 0.34
IGL01933:Recql APN 6 142364638 missense probably benign 0.33
IGL02026:Recql APN 6 142366668 nonsense probably null
IGL03181:Recql APN 6 142378192 missense probably benign 0.00
K3955:Recql UTSW 6 142378206 nonsense probably null
R0380:Recql UTSW 6 142369430 missense probably damaging 1.00
R1742:Recql UTSW 6 142364572 missense probably damaging 1.00
R1780:Recql UTSW 6 142364598 missense probably benign 0.00
R1921:Recql UTSW 6 142365589 missense probably benign 0.41
R2032:Recql UTSW 6 142367283 missense probably damaging 1.00
R2966:Recql UTSW 6 142363587 missense probably benign 0.10
R4666:Recql UTSW 6 142376841 missense probably damaging 1.00
R4779:Recql UTSW 6 142363700 intron probably benign
R4863:Recql UTSW 6 142359006 utr 3 prime probably benign
R5115:Recql UTSW 6 142358559 utr 3 prime probably benign
R5400:Recql UTSW 6 142362347 intron probably benign
R5781:Recql UTSW 6 142365618 splice site probably null
R5981:Recql UTSW 6 142372878 missense probably damaging 1.00
R6372:Recql UTSW 6 142376840 missense probably damaging 1.00
R6651:Recql UTSW 6 142364434 critical splice donor site probably null
R6786:Recql UTSW 6 142364552 missense probably benign 0.43
R7399:Recql UTSW 6 142374884 missense probably damaging 1.00
R7515:Recql UTSW 6 142374885 missense probably damaging 1.00
R8097:Recql UTSW 6 142374911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGGCAATCATTCACCCTAGC -3'
(R):5'- GTATCGTGGTCCACCAACTTGACTC -3'

Sequencing Primer
(F):5'- GGTGGTTCTCTGAAAACCCAG -3'
(R):5'- GGTCCACCAACTTGACTCTACTC -3'
Posted On2014-02-18