Mutagenetix > Incidental Mutations

Incidental Mutation 'R1371:Recql'

157311

Institutional Source

Beutler Lab

Gene Symbol

Recql

Ensembl Gene

ENSMUSG00000030243

Gene Name

RecQ protein-like

Synonyms

RecQ1

MMRRC Submission

039435-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.313) question?

Stock #

R1371 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142350342-142387087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 142372875 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 214 (T214M)

Ref Sequence

ENSEMBL: ENSMUSP00000107434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000100832] [ENSMUST00000111803] [ENSMUST00000128082] [ENSMUST00000129694] [ENSMUST00000203772]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032370
AA Change: T214M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243
AA Change: T214M

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	2.5e-27	SMART
HELICc	328	409	2.2e-26	SMART
Pfam:RQC	488	592	5.5e-6	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100832
AA Change: T214M

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243
AA Change: T214M

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RQC	488	592	1.1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111803
AA Change: T214M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243
AA Change: T214M

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
DEXDc	88	291	6e-25	SMART
HELICc	328	409	5.51e-24	SMART
Pfam:RecQ_Zn_bind	420	479	2.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128082

SMART Domains

Protein: ENSMUSP00000120951
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
Blast:DEXDc	24	84	4e-16	BLAST
PDB:2WWY\|B	63	85	9e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000129694

SMART Domains

Protein: ENSMUSP00000122328
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
Pfam:DEAD	93	166	6.6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155149

Predicted Effect

probably benign
Transcript: ENSMUST00000203772

SMART Domains

Protein: ENSMUSP00000145179
Gene: ENSMUSG00000030243

Domain	Start	End	E-Value	Type
coiled coil region	6	51	N/A	INTRINSIC
Pfam:DEAD	93	166	8.5e-12	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. The encoded protein is involved in the processing of Holliday junctions, the suppression of sister chromatid exchanges, telomere maintenance, and is required for genotoxic stress resistance. Defects in this gene have been associated with several types of cancer. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in chromosomal instability, with embryonic fibroblasts exhibiting aneuploidy, spontaneous chromosomal breakage, frequent translocation events, increased sensitivity to ionizing radiation, and increased frequency of sister chromatid exchange. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Recql

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Recql	APN	6	142376921	missense	probably null	0.34
IGL01933:Recql	APN	6	142364638	missense	probably benign	0.33
IGL02026:Recql	APN	6	142366668	nonsense	probably null
IGL03181:Recql	APN	6	142378192	missense	probably benign	0.00
K3955:Recql	UTSW	6	142378206	nonsense	probably null
R0380:Recql	UTSW	6	142369430	missense	probably damaging	1.00
R1742:Recql	UTSW	6	142364572	missense	probably damaging	1.00
R1780:Recql	UTSW	6	142364598	missense	probably benign	0.00
R1921:Recql	UTSW	6	142365589	missense	probably benign	0.41
R2032:Recql	UTSW	6	142367283	missense	probably damaging	1.00
R2966:Recql	UTSW	6	142363587	missense	probably benign	0.10
R4666:Recql	UTSW	6	142376841	missense	probably damaging	1.00
R4779:Recql	UTSW	6	142363700	intron	probably benign
R4863:Recql	UTSW	6	142359006	utr 3 prime	probably benign
R5115:Recql	UTSW	6	142358559	utr 3 prime	probably benign
R5400:Recql	UTSW	6	142362347	intron	probably benign
R5781:Recql	UTSW	6	142365618	splice site	probably null
R5981:Recql	UTSW	6	142372878	missense	probably damaging	1.00
R6372:Recql	UTSW	6	142376840	missense	probably damaging	1.00
R6651:Recql	UTSW	6	142364434	critical splice donor site	probably null
R6786:Recql	UTSW	6	142364552	missense	probably benign	0.43
R7399:Recql	UTSW	6	142374884	missense	probably damaging	1.00
R7515:Recql	UTSW	6	142374885	missense	probably damaging	1.00
R8097:Recql	UTSW	6	142374911	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATGGCAATCATTCACCCTAGC -3'
(R):5'- GTATCGTGGTCCACCAACTTGACTC -3'

Sequencing Primer
(F):5'- GGTGGTTCTCTGAAAACCCAG -3'
(R):5'- GGTCCACCAACTTGACTCTACTC -3'

Posted On

2014-02-18