Incidental Mutation 'R1371:Lig1'
ID157312
Institutional Source Beutler Lab
Gene Symbol Lig1
Ensembl Gene ENSMUSG00000056394
Gene Nameligase I, DNA, ATP-dependent
SynonymsLigI, mLigI
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1371 (G1)
Quality Score211
Status Validated
Chromosome7
Chromosomal Location13277283-13311433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13288685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 147 (R147Q)
Ref Sequence ENSEMBL: ENSMUSP00000136972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000123025] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]
Predicted Effect probably damaging
Transcript: ENSMUST00000098814
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: R147Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123025
AA Change: R146Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394
AA Change: R146Q

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 159 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146998
AA Change: R147Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394
AA Change: R147Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
low complexity region 160 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165964
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: R147Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177588
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: R147Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185145
AA Change: R147Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394
AA Change: R147Q

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
PDB:1X9N|A 247 313 3e-24 PDB
Meta Mutation Damage Score 0.1150 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Lig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Lig1 APN 7 13301452 nonsense probably null
IGL00499:Lig1 APN 7 13298830 critical splice donor site probably null
IGL01465:Lig1 APN 7 13296391 missense probably benign 0.19
IGL01804:Lig1 APN 7 13309206 missense probably benign 0.43
IGL02068:Lig1 APN 7 13292451 splice site probably benign
IGL02955:Lig1 APN 7 13296347 missense probably damaging 0.99
IGL03188:Lig1 APN 7 13311107 splice site probably benign
IGL03327:Lig1 APN 7 13303855 missense probably damaging 1.00
IGL03411:Lig1 APN 7 13296768 missense probably damaging 1.00
PIT4142001:Lig1 UTSW 7 13305924 frame shift probably null
R0085:Lig1 UTSW 7 13307570 missense possibly damaging 0.66
R0348:Lig1 UTSW 7 13309197 missense probably damaging 1.00
R0362:Lig1 UTSW 7 13296804 unclassified probably benign
R0787:Lig1 UTSW 7 13299069 missense probably benign 0.41
R1170:Lig1 UTSW 7 13292153 missense probably benign 0.00
R1610:Lig1 UTSW 7 13285340 missense probably damaging 1.00
R1809:Lig1 UTSW 7 13300355 splice site probably benign
R1986:Lig1 UTSW 7 13309142 nonsense probably null
R2106:Lig1 UTSW 7 13305938 missense probably damaging 1.00
R2343:Lig1 UTSW 7 13292195 splice site probably null
R2380:Lig1 UTSW 7 13303796 splice site probably benign
R3545:Lig1 UTSW 7 13292163 missense possibly damaging 0.82
R4669:Lig1 UTSW 7 13311028 missense probably damaging 1.00
R4928:Lig1 UTSW 7 13298738 missense probably damaging 1.00
R5167:Lig1 UTSW 7 13311058 missense probably damaging 0.97
R5249:Lig1 UTSW 7 13308507 missense possibly damaging 0.60
R5351:Lig1 UTSW 7 13300949 missense probably damaging 1.00
R5373:Lig1 UTSW 7 13305923 frame shift probably null
R5607:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5608:Lig1 UTSW 7 13306008 missense probably damaging 0.97
R5620:Lig1 UTSW 7 13286606 missense possibly damaging 0.66
R5799:Lig1 UTSW 7 13296258 missense possibly damaging 0.67
R6057:Lig1 UTSW 7 13288672 missense probably damaging 0.99
R6897:Lig1 UTSW 7 13305914 missense probably damaging 1.00
R7202:Lig1 UTSW 7 13291249 missense probably benign 0.00
R7454:Lig1 UTSW 7 13288721 missense probably damaging 0.99
R7548:Lig1 UTSW 7 13301418 missense possibly damaging 0.79
R7596:Lig1 UTSW 7 13305998 missense probably damaging 1.00
R7597:Lig1 UTSW 7 13296344 missense probably benign
R7688:Lig1 UTSW 7 13289463 missense probably benign
R7733:Lig1 UTSW 7 13296231 missense possibly damaging 0.87
R8104:Lig1 UTSW 7 13286565 missense possibly damaging 0.46
X0020:Lig1 UTSW 7 13296774 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACACTGGGGTAGTGGCTATGATAGG -3'
(R):5'- TGGCTGGGTCAACAACTGCAAC -3'

Sequencing Primer
(F):5'- gggtagtggctATGATAGGTAAGAAG -3'
(R):5'- GTCAACAACTGCAACTGGTG -3'
Posted On2014-02-18