Mutagenetix > Incidental Mutations

Incidental Mutation 'R1371:Lig1'

157312

Institutional Source

Beutler Lab

Gene Symbol

Lig1

Ensembl Gene

ENSMUSG00000056394

Gene Name

ligase I, DNA, ATP-dependent

Synonyms

LigI, mLigI

MMRRC Submission

039435-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1371 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

13277283-13311433 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13288685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 147 (R147Q)

Ref Sequence

ENSEMBL: ENSMUSP00000136972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000123025] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000098814
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: R147Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123025
AA Change: R146Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394
AA Change: R146Q

Domain	Start	End	E-Value	Type
low complexity region	96	111	N/A	INTRINSIC
low complexity region	159	177	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123846

SMART Domains

Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146998
AA Change: R147Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394
AA Change: R147Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
low complexity region	160	178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147735

SMART Domains

Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148471

SMART Domains

Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156525

SMART Domains

Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165964
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: R147Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	302	478	1.7e-40	PFAM
Pfam:DNA_ligase_A_M	556	760	1.1e-69	PFAM
Pfam:DNA_ligase_A_C	785	896	1.6e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177588
AA Change: R147Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: R147Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185145
AA Change: R147Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394
AA Change: R147Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
PDB:1X9N\|A	247	313	3e-24	PDB

Meta Mutation Damage Score

0.1150

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Lig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Lig1	APN	7	13301452	nonsense	probably null
IGL00499:Lig1	APN	7	13298830	critical splice donor site	probably null
IGL01465:Lig1	APN	7	13296391	missense	probably benign	0.19
IGL01804:Lig1	APN	7	13309206	missense	probably benign	0.43
IGL02068:Lig1	APN	7	13292451	splice site	probably benign
IGL02955:Lig1	APN	7	13296347	missense	probably damaging	0.99
IGL03188:Lig1	APN	7	13311107	splice site	probably benign
IGL03327:Lig1	APN	7	13303855	missense	probably damaging	1.00
IGL03411:Lig1	APN	7	13296768	missense	probably damaging	1.00
PIT4142001:Lig1	UTSW	7	13305924	frame shift	probably null
R0085:Lig1	UTSW	7	13307570	missense	possibly damaging	0.66
R0348:Lig1	UTSW	7	13309197	missense	probably damaging	1.00
R0362:Lig1	UTSW	7	13296804	unclassified	probably benign
R0787:Lig1	UTSW	7	13299069	missense	probably benign	0.41
R1170:Lig1	UTSW	7	13292153	missense	probably benign	0.00
R1610:Lig1	UTSW	7	13285340	missense	probably damaging	1.00
R1809:Lig1	UTSW	7	13300355	splice site	probably benign
R1986:Lig1	UTSW	7	13309142	nonsense	probably null
R2106:Lig1	UTSW	7	13305938	missense	probably damaging	1.00
R2343:Lig1	UTSW	7	13292195	splice site	probably null
R2380:Lig1	UTSW	7	13303796	splice site	probably benign
R3545:Lig1	UTSW	7	13292163	missense	possibly damaging	0.82
R4669:Lig1	UTSW	7	13311028	missense	probably damaging	1.00
R4928:Lig1	UTSW	7	13298738	missense	probably damaging	1.00
R5167:Lig1	UTSW	7	13311058	missense	probably damaging	0.97
R5249:Lig1	UTSW	7	13308507	missense	possibly damaging	0.60
R5351:Lig1	UTSW	7	13300949	missense	probably damaging	1.00
R5373:Lig1	UTSW	7	13305923	frame shift	probably null
R5607:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5608:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5620:Lig1	UTSW	7	13286606	missense	possibly damaging	0.66
R5799:Lig1	UTSW	7	13296258	missense	possibly damaging	0.67
R6057:Lig1	UTSW	7	13288672	missense	probably damaging	0.99
R6897:Lig1	UTSW	7	13305914	missense	probably damaging	1.00
R7202:Lig1	UTSW	7	13291249	missense	probably benign	0.00
R7454:Lig1	UTSW	7	13288721	missense	probably damaging	0.99
R7548:Lig1	UTSW	7	13301418	missense	possibly damaging	0.79
R7596:Lig1	UTSW	7	13305998	missense	probably damaging	1.00
R7597:Lig1	UTSW	7	13296344	missense	probably benign
R7688:Lig1	UTSW	7	13289463	missense	probably benign
R7733:Lig1	UTSW	7	13296231	missense	possibly damaging	0.87
R8104:Lig1	UTSW	7	13286565	missense	possibly damaging	0.46
R8887:Lig1	UTSW	7	13296787	missense	probably damaging	1.00
R9025:Lig1	UTSW	7	13303820	missense	probably damaging	1.00
R9321:Lig1	UTSW	7	13301009	missense	probably damaging	1.00
X0020:Lig1	UTSW	7	13296774	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- ACACTGGGGTAGTGGCTATGATAGG -3'
(R):5'- TGGCTGGGTCAACAACTGCAAC -3'

Sequencing Primer
(F):5'- gggtagtggctATGATAGGTAAGAAG -3'
(R):5'- GTCAACAACTGCAACTGGTG -3'

Posted On

2014-02-18