Incidental Mutation 'R1371:Aldh16a1'
ID 157315
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 039435-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1371 (G1)
Quality Score 128
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 44796674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 275 (T275K)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000211362] [ENSMUST00000210125] [ENSMUST00000211169]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000007977
AA Change: T275K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007977
Gene: ENSMUSG00000007833
AA Change: T275K

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 1.1e-84 PFAM
Pfam:Aldedh 537 774 4.7e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107815
AA Change: T275K

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: T275K

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect possibly damaging
Transcript: ENSMUST00000209963
AA Change: T275K

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Meta Mutation Damage Score 0.4341 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,844,379 (GRCm39) D884V probably damaging Het
Acvr2a C T 2: 48,789,628 (GRCm39) T457M probably damaging Het
Akr1b10 C T 6: 34,369,394 (GRCm39) T208I probably benign Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Asgr1 T G 11: 69,946,923 (GRCm39) C56W probably benign Het
Atp11b T C 3: 35,860,918 (GRCm39) I335T probably damaging Het
BC061237 A G 14: 44,741,762 (GRCm39) probably benign Het
Bdh1 G T 16: 31,275,720 (GRCm39) K280N probably benign Het
Bmp1 C T 14: 70,729,906 (GRCm39) C466Y probably damaging Het
Ccdc181 A G 1: 164,108,172 (GRCm39) E285G probably benign Het
Ces1f C T 8: 94,006,277 (GRCm39) G18R probably damaging Het
Cfap43 T A 19: 47,824,045 (GRCm39) I109L possibly damaging Het
Cma2 T C 14: 56,210,283 (GRCm39) L56S probably damaging Het
Edc4 A G 8: 106,617,382 (GRCm39) probably benign Het
F3 T C 3: 121,526,159 (GRCm39) C241R probably damaging Het
Fhdc1 T A 3: 84,352,310 (GRCm39) S972C probably damaging Het
Heatr1 T G 13: 12,432,513 (GRCm39) I1086R possibly damaging Het
Hsh2d A T 8: 72,950,738 (GRCm39) probably benign Het
Ice1 T C 13: 70,744,340 (GRCm39) Y2081C probably damaging Het
Il1rl1 A G 1: 40,481,873 (GRCm39) N194D probably damaging Het
Ip6k1 G A 9: 107,923,022 (GRCm39) V385M probably damaging Het
Lig1 G A 7: 13,022,611 (GRCm39) R147Q probably damaging Het
Lrp1b C T 2: 40,537,165 (GRCm39) V41I probably damaging Het
Macroh2a2 A T 10: 61,585,112 (GRCm39) D177E possibly damaging Het
Mst1r T A 9: 107,794,424 (GRCm39) V1201E probably damaging Het
Myof T C 19: 37,892,116 (GRCm39) probably benign Het
Nbas G T 12: 13,532,379 (GRCm39) probably benign Het
Ndst1 A G 18: 60,840,719 (GRCm39) I321T possibly damaging Het
Nek10 G A 14: 14,850,983 (GRCm38) G343R probably damaging Het
Or2a7 A T 6: 43,151,234 (GRCm39) T105S probably benign Het
Or2y1 T A 11: 49,385,650 (GRCm39) C97S probably damaging Het
Or4d2b A T 11: 87,780,122 (GRCm39) I200N probably damaging Het
Pde4d T C 13: 109,253,595 (GRCm39) S141P probably benign Het
Pigm A T 1: 172,204,381 (GRCm39) Q39L probably damaging Het
Prl7a2 T A 13: 27,846,750 (GRCm39) I88F probably benign Het
Prss16 T A 13: 22,192,856 (GRCm39) probably benign Het
Psmc4 G A 7: 27,742,222 (GRCm39) probably benign Het
Ptger3 T A 3: 157,273,365 (GRCm39) C237* probably null Het
Recql G A 6: 142,318,601 (GRCm39) T214M probably damaging Het
Rfx7 T A 9: 72,526,857 (GRCm39) V1349D probably damaging Het
Ros1 A G 10: 51,964,041 (GRCm39) S1740P probably damaging Het
Rrm2b A T 15: 37,947,053 (GRCm39) S83T probably benign Het
Sall4 A G 2: 168,598,394 (GRCm39) Y149H probably benign Het
Smad1 A G 8: 80,076,207 (GRCm39) probably benign Het
Snrnp70 T C 7: 45,030,129 (GRCm39) probably benign Het
Spef2 C A 15: 9,725,194 (GRCm39) probably benign Het
Sptlc1 T C 13: 53,505,660 (GRCm39) T253A probably benign Het
Zbbx T C 3: 74,959,784 (GRCm39) Y595C possibly damaging Het
Zfp382 T C 7: 29,833,114 (GRCm39) V255A probably benign Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TATTTGGAGAGATATGGCGGACCCC -3'
(R):5'- TTGCAGGAGTCATTGGCCTCATC -3'

Sequencing Primer
(F):5'- ATATGGCGGACCCCTGAAC -3'
(R):5'- AGGTAAAGTCTCTGGTGCCC -3'
Posted On 2014-02-18