Incidental Mutation 'R1371:Snrnp70'
ID157316
Institutional Source Beutler Lab
Gene Symbol Snrnp70
Ensembl Gene ENSMUSG00000063511
Gene Namesmall nuclear ribonucleoprotein 70 (U1)
SynonymsSrnp70, 2700022N21Rik, Rnulp70, Snrp70, U1-70, 3200002N22Rik
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45376453-45395742 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 45380705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074575] [ENSMUST00000209858] [ENSMUST00000210514] [ENSMUST00000211211] [ENSMUST00000211378]
AlphaFold Q62376
Predicted Effect probably benign
Transcript: ENSMUST00000074575
SMART Domains Protein: ENSMUSP00000074160
Gene: ENSMUSG00000063511

DomainStartEndE-ValueType
Pfam:U1snRNP70_N 2 94 4e-31 PFAM
RRM 104 177 1.62e-23 SMART
low complexity region 186 203 N/A INTRINSIC
coiled coil region 286 309 N/A INTRINSIC
low complexity region 331 409 N/A INTRINSIC
PDB:3PGW|L 410 448 4e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209858
Predicted Effect probably benign
Transcript: ENSMUST00000209993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210495
Predicted Effect probably benign
Transcript: ENSMUST00000210514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211178
Predicted Effect probably benign
Transcript: ENSMUST00000211211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211366
Predicted Effect probably benign
Transcript: ENSMUST00000211378
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a subunit of the U1 snRNP (small nuclear ribonucleic particle), one of at least five snRNPs to comprise the spliceosome, which functions in processing of pre-mRNAs. The U1 snRNP has been shown to be important in defining the 5' splice site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Snrnp70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Snrnp70 APN 7 45377354 critical splice donor site probably null
IGL01092:Snrnp70 APN 7 45377377 missense probably damaging 0.98
IGL01444:Snrnp70 APN 7 45387236 splice site probably null
IGL03110:Snrnp70 APN 7 45376859 intron probably benign
R0691:Snrnp70 UTSW 7 45387245 missense possibly damaging 0.60
R1854:Snrnp70 UTSW 7 45377220 nonsense probably null
R1880:Snrnp70 UTSW 7 45377362 splice site probably null
R2050:Snrnp70 UTSW 7 45387300 nonsense probably null
R4928:Snrnp70 UTSW 7 45377281 splice site probably null
R5195:Snrnp70 UTSW 7 45394710 missense probably damaging 1.00
R5314:Snrnp70 UTSW 7 45377052 nonsense probably null
R5326:Snrnp70 UTSW 7 45377233 intron probably benign
R5522:Snrnp70 UTSW 7 45377177 intron probably benign
R6182:Snrnp70 UTSW 7 45377073 nonsense probably null
R6739:Snrnp70 UTSW 7 45387419 missense probably damaging 1.00
R7607:Snrnp70 UTSW 7 45392264 missense possibly damaging 0.82
R7789:Snrnp70 UTSW 7 45376621 nonsense probably null
R7840:Snrnp70 UTSW 7 45376790 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACTCATGCAGGAAAGACCAGGG -3'
(R):5'- AGCAGAGGCCAGCATTCAGCTAAC -3'

Sequencing Primer
(F):5'- ACCAGTGTCCAAAGCCATG -3'
(R):5'- GGCCAGAGTAAATGTTTTACCCC -3'
Posted On2014-02-18