Mutagenetix > Incidental Mutation

Incidental Mutation 'R1371:Ip6k1'

157323

Institutional Source

Beutler Lab

Gene Symbol

Ip6k1

Ensembl Gene

ENSMUSG00000032594

Gene Name

inositol hexaphosphate kinase 1

Synonyms

1200016D08Rik, InsP6, Ihpk1, InsP6k1

MMRRC Submission

039435-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R1371 (G1)

Quality Score

141

Status

Validated

Chromosome

Chromosomal Location

108002501-108048782 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 108045823 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 385 (V385M)

Ref Sequence

ENSEMBL: ENSMUSP00000035214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047947] [ENSMUST00000112295] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176566] [ENSMUST00000177158]

AlphaFold

Q6PD10

Predicted Effect

probably damaging
Transcript: ENSMUST00000035214
AA Change: V385M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: V385M

Domain	Start	End	E-Value	Type
low complexity region	114	129	N/A	INTRINSIC
Pfam:IPK	207	426	2.2e-67	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000047947

SMART Domains

Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	234	8e-48	PFAM
Pfam:NTP_transf_3	3	202	6.6e-12	PFAM
Pfam:Hexapep	259	294	1.8e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112295

SMART Domains

Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	2	235	2.1e-51	PFAM
Pfam:NTP_transf_3	3	199	1.1e-11	PFAM
Pfam:Hexapep	259	294	9.4e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150700

Predicted Effect

probably benign
Transcript: ENSMUST00000164395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167159

Predicted Effect

probably benign
Transcript: ENSMUST00000175874

SMART Domains

Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594

Domain	Start	End	E-Value	Type
low complexity region	114	129	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176454

Predicted Effect

probably benign
Transcript: ENSMUST00000176566

Predicted Effect

probably benign
Transcript: ENSMUST00000176613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177396

Predicted Effect

probably benign
Transcript: ENSMUST00000177158

SMART Domains

Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594

Domain	Start	End	E-Value	Type
low complexity region	15	30	N/A	INTRINSIC
Pfam:IPK	108	206	1.5e-26	PFAM

Meta Mutation Damage Score

0.7788

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Ip6k1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01286:Ip6k1	APN	9	108045883	missense	probably benign	0.01
R0147:Ip6k1	UTSW	9	108045894	missense	probably damaging	1.00
R1530:Ip6k1	UTSW	9	108045562	nonsense	probably null
R1716:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1717:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1718:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1719:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1741:Ip6k1	UTSW	9	108040984	missense	probably benign	0.43
R1745:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1747:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1901:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1902:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1903:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R1962:Ip6k1	UTSW	9	108041088	critical splice donor site	probably null
R2126:Ip6k1	UTSW	9	108040996	missense	possibly damaging	0.89
R3809:Ip6k1	UTSW	9	108045887	missense	probably damaging	1.00
R5000:Ip6k1	UTSW	9	108045599	nonsense	probably null
R6074:Ip6k1	UTSW	9	108024109	utr 5 prime	probably benign
R6921:Ip6k1	UTSW	9	108024435	missense	probably damaging	1.00
R7069:Ip6k1	UTSW	9	108045452	splice site	probably null
R7154:Ip6k1	UTSW	9	108045662	missense	probably damaging	1.00
R7218:Ip6k1	UTSW	9	108045582	missense	unknown
R7330:Ip6k1	UTSW	9	108045253	missense	possibly damaging	0.56
R7731:Ip6k1	UTSW	9	108044728	missense	probably damaging	1.00
R7736:Ip6k1	UTSW	9	108045692	missense	probably damaging	1.00
R7765:Ip6k1	UTSW	9	108032089	missense	possibly damaging	0.52
R7941:Ip6k1	UTSW	9	108024432	missense	probably damaging	1.00
R8221:Ip6k1	UTSW	9	108045916	missense	probably benign	0.40
R8383:Ip6k1	UTSW	9	108044727	missense	possibly damaging	0.81
R8815:Ip6k1	UTSW	9	108041012	missense	probably benign	0.38
X0021:Ip6k1	UTSW	9	108032190	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCCAATCCTGAGCAAACTGCG -3'
(R):5'- AGCAAGTTCAGAGCAATGGTCCC -3'

Sequencing Primer
(F):5'- TCAAAGCCGTACTGGAGC -3'
(R):5'- AGCAATGGTCCCTGCCTG -3'

Posted On

2014-02-18