Incidental Mutation 'R1371:Asgr1'
ID157327
Institutional Source Beutler Lab
Gene Symbol Asgr1
Ensembl Gene ENSMUSG00000020884
Gene Nameasialoglycoprotein receptor 1
SynonymsAsgr-1, Asgr, ASGPR1
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70054085-70057894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70056097 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 56 (C56W)
Ref Sequence ENSEMBL: ENSMUSP00000121842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018699] [ENSMUST00000092959] [ENSMUST00000108585] [ENSMUST00000123369] [ENSMUST00000146411]
Predicted Effect probably benign
Transcript: ENSMUST00000018699
AA Change: C56W

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000018699
Gene: ENSMUSG00000020884
AA Change: C56W

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092959
AA Change: C56W

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000090637
Gene: ENSMUSG00000020884
AA Change: C56W

DomainStartEndE-ValueType
Pfam:Lectin_N 6 143 1.1e-67 PFAM
CLECT 153 277 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108585
AA Change: C56W

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104226
Gene: ENSMUSG00000020884
AA Change: C56W

DomainStartEndE-ValueType
Blast:GuKc 1 112 1e-24 BLAST
CLECT 124 248 2.23e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123369
SMART Domains Protein: ENSMUSP00000137469
Gene: ENSMUSG00000020884

DomainStartEndE-ValueType
Pfam:Lectin_N 1 43 2e-19 PFAM
CLECT 53 129 9.83e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146411
AA Change: C56W

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121842
Gene: ENSMUSG00000020884
AA Change: C56W

DomainStartEndE-ValueType
Pfam:Lectin_N 13 143 4.7e-55 PFAM
CLECT 153 277 2.23e-40 SMART
Meta Mutation Damage Score 0.5882 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired hepatic clearance of asialoglycoproteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Asgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02651:Asgr1 APN 11 70057130 missense possibly damaging 0.65
R1471:Asgr1 UTSW 11 70056093 missense possibly damaging 0.82
R1980:Asgr1 UTSW 11 70054946 missense probably damaging 1.00
R2186:Asgr1 UTSW 11 70056249 missense probably benign 0.02
R5757:Asgr1 UTSW 11 70054952 missense probably benign 0.01
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6037:Asgr1 UTSW 11 70056421 missense probably benign 0.00
R6478:Asgr1 UTSW 11 70056894 missense possibly damaging 0.94
R6963:Asgr1 UTSW 11 70055968 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCGTGGTTCATCGTCTGTAATGAC -3'
(R):5'- TGCCTTAGAGCCAGCAGATCTTCC -3'

Sequencing Primer
(F):5'- CCTCTTAGTCTACTGGAGAGCTTAG -3'
(R):5'- AGCAGATCTTCCCGGAGTTG -3'
Posted On2014-02-18