Incidental Mutation 'R1371:Olfr462'
ID157328
Institutional Source Beutler Lab
Gene Symbol Olfr462
Ensembl Gene ENSMUSG00000093839
Gene Nameolfactory receptor 462
SynonymsMOR240-3, GA_x6K02T2PAEV-9536824-9535889
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87884979-87892268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87889296 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 200 (I200N)
Ref Sequence ENSEMBL: ENSMUSP00000150179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049743] [ENSMUST00000081417] [ENSMUST00000213672] [ENSMUST00000213928] [ENSMUST00000215150] [ENSMUST00000217095]
Predicted Effect probably damaging
Transcript: ENSMUST00000049743
AA Change: I200N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055334
Gene: ENSMUSG00000093839
AA Change: I200N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.2e-40 PFAM
Pfam:7tm_1 41 287 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081417
SMART Domains Protein: ENSMUSP00000080146
Gene: ENSMUSG00000093920

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.3e-41 PFAM
Pfam:7tm_1 41 287 8.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213672
AA Change: I200N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213928
AA Change: I200N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215150
Predicted Effect probably benign
Transcript: ENSMUST00000217095
Meta Mutation Damage Score 0.4162 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Olfr462
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0613:Olfr462 UTSW 11 87889227 missense possibly damaging 0.90
R1116:Olfr462 UTSW 11 87889408 missense probably benign 0.00
R1415:Olfr462 UTSW 11 87889647 missense possibly damaging 0.91
R1444:Olfr462 UTSW 11 87889759 missense probably benign 0.00
R4591:Olfr462 UTSW 11 87889549 missense probably benign 0.35
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R5019:Olfr462 UTSW 11 87888975 missense probably benign
R5521:Olfr462 UTSW 11 87889719 missense probably damaging 0.99
R6967:Olfr462 UTSW 11 87889498 missense probably benign 0.02
R7186:Olfr462 UTSW 11 87889765 missense possibly damaging 0.69
R8025:Olfr462 UTSW 11 87888951 critical splice donor site probably null
R8245:Olfr462 UTSW 11 87889617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCCTGGTTCCTGAGCGTGTAG -3'
(R):5'- ATGCTGGTGGACTTCCTCTCTGAG -3'

Sequencing Primer
(F):5'- GCTGATGGATACTGCCTTGTC -3'
(R):5'- GGACTTCCTCTCTGAGAAGAAGAC -3'
Posted On2014-02-18