Mutagenetix > Incidental Mutation

Incidental Mutation 'R1371:Abca8b'

157329

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

039435-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1371 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109953553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 884 (D884V)

Ref Sequence

ENSEMBL: ENSMUSP00000102280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: D946V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: D946V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106669
AA Change: D884V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: D884V

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCCCTGGTGTAAGTAAAACAAGGCA -3'
(R):5'- ATGTGGGAAAGTACACACTGAAGCATT -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- CATTGAGATTCAGAACTTAACACGGG -3'

Posted On

2014-02-18