Incidental Mutation 'R1371:Sptlc1'
ID157334
Institutional Source Beutler Lab
Gene Symbol Sptlc1
Ensembl Gene ENSMUSG00000021468
Gene Nameserine palmitoyltransferase, long chain base subunit 1
SynonymsLcb1
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1371 (G1)
Quality Score123
Status Validated
Chromosome13
Chromosomal Location53332748-53377397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53351624 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 253 (T253A)
Ref Sequence ENSEMBL: ENSMUSP00000021920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021920]
Predicted Effect probably benign
Transcript: ENSMUST00000021920
AA Change: T253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021920
Gene: ENSMUSG00000021468
AA Change: T253A

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
Pfam:Aminotran_1_2 98 464 9.5e-44 PFAM
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a knock-out allele exhibit abnormal sphingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Sptlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sptlc1 APN 13 53367378 missense probably damaging 0.98
IGL01354:Sptlc1 APN 13 53333951 missense probably benign
IGL01773:Sptlc1 APN 13 53377298 missense probably damaging 0.96
IGL01876:Sptlc1 APN 13 53374012 missense probably benign 0.02
R0390:Sptlc1 UTSW 13 53337612 missense probably benign 0.06
R1961:Sptlc1 UTSW 13 53358880 missense probably benign
R2179:Sptlc1 UTSW 13 53351639 missense probably damaging 1.00
R2513:Sptlc1 UTSW 13 53337640 missense possibly damaging 0.61
R4357:Sptlc1 UTSW 13 53374032 missense probably damaging 1.00
R4989:Sptlc1 UTSW 13 53351656 missense probably damaging 0.97
R5055:Sptlc1 UTSW 13 53342182 missense probably benign 0.02
R6415:Sptlc1 UTSW 13 53351692 critical splice acceptor site probably null
R6752:Sptlc1 UTSW 13 53335358 missense possibly damaging 0.67
R7283:Sptlc1 UTSW 13 53344878 missense probably benign 0.03
R7548:Sptlc1 UTSW 13 53367932 missense possibly damaging 0.84
R7731:Sptlc1 UTSW 13 53333957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGTCAGACTTGCCACAAGC -3'
(R):5'- TGCCTAAGAGTGAACGGAAACTGC -3'

Sequencing Primer
(F):5'- TTGCCACAAGCCCCTTCAC -3'
(R):5'- GTGAACGGAAACTGCTTTTTCTC -3'
Posted On2014-02-18