Incidental Mutation 'R1371:Ice1'
ID157335
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70596221 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2081 (Y2081C)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: Y2081C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: Y2081C

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect unknown
Transcript: ENSMUST00000222274
AA Change: Y8C
Predicted Effect unknown
Transcript: ENSMUST00000223102
AA Change: Y11C
Meta Mutation Damage Score 0.2126 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGAAGCCTGTAATAGCGAC -3'
(R):5'- CGCATAGCGTAAATGGCAGTCCAG -3'

Sequencing Primer
(F):5'- GCCTGTAATAGCGACTTGGAC -3'
(R):5'- GCTGCTTTTGACCATACAGC -3'
Posted On2014-02-18