Mutagenetix > Incidental Mutations

Incidental Mutation 'R1371:Pde4d'

157336

Institutional Source

Beutler Lab

Gene Symbol

Pde4d

Ensembl Gene

ENSMUSG00000021699

Gene Name

phosphodiesterase 4D, cAMP specific

Synonyms

dunce, Dpde3, 9630011N22Rik

MMRRC Submission

039435-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1371 (G1)

Quality Score

131

Status

Validated

Chromosome

Chromosomal Location

108449948-109953461 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109117061 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 141 (S141P)

Ref Sequence

ENSEMBL: ENSMUSP00000112991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000177907]

Predicted Effect

probably benign
Transcript: ENSMUST00000120671
AA Change: S141P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: S141P

Domain	Start	End	E-Value	Type
low complexity region	45	84	N/A	INTRINSIC
HDc	454	629	1.12e-2	SMART
low complexity region	777	792	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122041

SMART Domains

Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138938

Predicted Effect

probably benign
Transcript: ENSMUST00000177907

SMART Domains

Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Meta Mutation Damage Score

0.1071

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Bmp1	C	T	14: 70,492,466	C466Y	probably damaging	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Pde4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Pde4d	APN	13	109936687	missense	possibly damaging	0.69
IGL00792:Pde4d	APN	13	109935395	missense	possibly damaging	0.85
IGL01014:Pde4d	APN	13	109949502	missense	probably damaging	1.00
IGL01660:Pde4d	APN	13	109938072	missense	probably damaging	1.00
IGL02233:Pde4d	APN	13	109740550	missense	probably damaging	1.00
IGL02405:Pde4d	APN	13	108860209	critical splice donor site	probably null
IGL02544:Pde4d	APN	13	109740523	missense	probably damaging	1.00
IGL02885:Pde4d	APN	13	109948261	missense	probably damaging	1.00
IGL03286:Pde4d	APN	13	109954506	unclassified	probably benign
IGL03406:Pde4d	APN	13	109954591	unclassified	probably benign
Heliosphere	UTSW	13	109116942	missense	probably benign
Stubbs	UTSW	13	109772722	intron	probably benign
IGL03055:Pde4d	UTSW	13	109935345	missense	probably damaging	1.00
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0357:Pde4d	UTSW	13	109951268	missense	possibly damaging	0.46
R0482:Pde4d	UTSW	13	109936710	missense	probably benign	0.00
R0689:Pde4d	UTSW	13	109740544	missense	possibly damaging	0.78
R0884:Pde4d	UTSW	13	109950940	missense	probably damaging	0.99
R1169:Pde4d	UTSW	13	109950928	splice site	probably null
R1225:Pde4d	UTSW	13	109950221	missense	probably benign	0.04
R1246:Pde4d	UTSW	13	109950973	missense	probably damaging	1.00
R1344:Pde4d	UTSW	13	109950387	nonsense	probably null
R1351:Pde4d	UTSW	13	109951275	missense	possibly damaging	0.46
R1418:Pde4d	UTSW	13	109950387	nonsense	probably null
R2197:Pde4d	UTSW	13	109948390	missense	probably damaging	1.00
R2440:Pde4d	UTSW	13	109927197	intron	probably benign
R3114:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3115:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3722:Pde4d	UTSW	13	109951332	nonsense	probably null
R3742:Pde4d	UTSW	13	109740479	missense	probably benign	0.42
R3797:Pde4d	UTSW	13	109632897	missense	probably benign	0.29
R3983:Pde4d	UTSW	13	109740406	missense	probably benign	0.23
R4618:Pde4d	UTSW	13	109933877	missense	probably benign	0.13
R4768:Pde4d	UTSW	13	109933874	missense	probably damaging	1.00
R4795:Pde4d	UTSW	13	109938171	intron	probably benign
R4824:Pde4d	UTSW	13	109116866	missense	probably benign	0.00
R4942:Pde4d	UTSW	13	108860199	missense	probably benign	0.00
R4984:Pde4d	UTSW	13	109740464	missense	probably damaging	1.00
R5180:Pde4d	UTSW	13	109740473	missense	probably benign	0.13
R5267:Pde4d	UTSW	13	109260809	intron	probably benign
R5311:Pde4d	UTSW	13	109632864	missense	probably benign	0.02
R5311:Pde4d	UTSW	13	109632865	missense	probably benign
R5376:Pde4d	UTSW	13	109772644	missense	probably benign	0.00
R5551:Pde4d	UTSW	13	109948396	critical splice donor site	probably null
R5753:Pde4d	UTSW	13	109772722	intron	probably benign
R5754:Pde4d	UTSW	13	109938013	missense	probably damaging	0.98
R5838:Pde4d	UTSW	13	109740442	missense	probably damaging	0.99
R5864:Pde4d	UTSW	13	109938048	missense	probably benign	0.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6049:Pde4d	UTSW	13	109032585	nonsense	probably null
R6214:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6215:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6273:Pde4d	UTSW	13	109950221	missense	possibly damaging	0.94
R6431:Pde4d	UTSW	13	109601786	unclassified	probably null
R6501:Pde4d	UTSW	13	109116942	missense	probably benign
R6534:Pde4d	UTSW	13	109632901	missense	probably benign	0.05
R6709:Pde4d	UTSW	13	109948279	missense	probably damaging	1.00
R6722:Pde4d	UTSW	13	109632898	nonsense	probably null
R7164:Pde4d	UTSW	13	109032688	missense	probably benign
R7222:Pde4d	UTSW	13	109757579	missense	probably damaging	1.00
R7417:Pde4d	UTSW	13	109632788	synonymous	probably null
R7489:Pde4d	UTSW	13	109116767	missense	unknown
R7563:Pde4d	UTSW	13	109951007	missense	probably benign	0.37
R7861:Pde4d	UTSW	13	109935324	missense	probably damaging	0.99
R7944:Pde4d	UTSW	13	109935324	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCGCTACAAGTCGGAAGCTGAG -3'
(R):5'- TCTAGGGCAAGGACAGACACGC -3'

Sequencing Primer
(F):5'- CATCACCACCTgccccc -3'
(R):5'- GACAGACACGCCCCTGC -3'

Posted On

2014-02-18