Incidental Mutation 'R1371:Nek10'
ID 157337
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene Name NIMA (never in mitosis gene a)- related kinase 10
Synonyms LOC238944
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1371 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 14803415-15012059 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14850983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 343 (G343R)
Ref Sequence ENSEMBL: ENSMUSP00000153142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
AlphaFold Q3UGM2
Predicted Effect probably damaging
Transcript: ENSMUST00000112630
AA Change: G343R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: G343R

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112631
AA Change: G343R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: G343R

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224491
AA Change: G343R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.2295 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 splice site probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7102:Nek10 UTSW 14 14828517 missense probably damaging 1.00
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
R7826:Nek10 UTSW 14 14860846 splice site probably null
R7986:Nek10 UTSW 14 15001020 missense probably benign 0.17
R8765:Nek10 UTSW 14 14999104 missense probably damaging 0.97
R8856:Nek10 UTSW 14 14937610 missense probably damaging 0.96
R8973:Nek10 UTSW 14 14931321 critical splice donor site probably null
R9002:Nek10 UTSW 14 14980590 missense probably damaging 1.00
R9088:Nek10 UTSW 14 14931314 missense probably damaging 1.00
R9195:Nek10 UTSW 14 14821139 missense probably benign 0.03
Z1177:Nek10 UTSW 14 14853948 missense probably benign 0.00
Z1177:Nek10 UTSW 14 15001157 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCAGATCAAGGAGCAGGTGAAA -3'
(R):5'- ATGTTCCCAAACATGGTAGCAATTTGTG -3'

Sequencing Primer
(F):5'- TCAAGGAGCAGGTGAAACTCTATG -3'
(R):5'- gtgtttctcttttcctgctacc -3'
Posted On 2014-02-18