Mutagenetix > Incidental Mutation

Incidental Mutation 'R1371:Bmp1'

157340

Institutional Source

Beutler Lab

Gene Symbol

Bmp1

Ensembl Gene

ENSMUSG00000022098

Gene Name

bone morphogenetic protein 1

Synonyms

MMRRC Submission

039435-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1371 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70474558-70520234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70492466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 466 (C466Y)

Ref Sequence

ENSEMBL: ENSMUSP00000022693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]

AlphaFold

P98063

Predicted Effect

probably damaging
Transcript: ENSMUST00000022693
AA Change: C466Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: C466Y

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
ZnMc	131	273	1.32e-54	SMART
CUB	327	439	4.35e-43	SMART
CUB	440	552	7.86e-50	SMART
EGF_CA	552	593	5.03e-11	SMART
CUB	596	708	1.13e-50	SMART
EGF_CA	708	748	4.81e-8	SMART
CUB	752	864	3.99e-51	SMART
CUB	865	981	7.35e-41	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226601

Predicted Effect

probably benign
Transcript: ENSMUST00000226906

Predicted Effect

probably benign
Transcript: ENSMUST00000227944

Meta Mutation Damage Score

0.9733

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.7%
20x: 89.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,553	D884V	probably damaging	Het
Acvr2a	C	T	2: 48,899,616	T457M	probably damaging	Het
Akr1b10	C	T	6: 34,392,459	T208I	probably benign	Het
Aldh16a1	G	T	7: 45,147,250	T275K	possibly damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Asgr1	T	G	11: 70,056,097	C56W	probably benign	Het
Atp11b	T	C	3: 35,806,769	I335T	probably damaging	Het
BC061237	A	G	14: 44,504,305		probably benign	Het
Bdh1	G	T	16: 31,456,902	K280N	probably benign	Het
Ccdc181	A	G	1: 164,280,603	E285G	probably benign	Het
Ces1f	C	T	8: 93,279,649	G18R	probably damaging	Het
Cfap43	T	A	19: 47,835,606	I109L	possibly damaging	Het
Cma2	T	C	14: 55,972,826	L56S	probably damaging	Het
Edc4	A	G	8: 105,890,750		probably benign	Het
F3	T	C	3: 121,732,510	C241R	probably damaging	Het
Fhdc1	T	A	3: 84,445,003	S972C	probably damaging	Het
H2afy2	A	T	10: 61,749,333	D177E	possibly damaging	Het
Heatr1	T	G	13: 12,417,632	I1086R	possibly damaging	Het
Hsh2d	A	T	8: 72,196,894		probably benign	Het
Ice1	T	C	13: 70,596,221	Y2081C	probably damaging	Het
Il1rl1	A	G	1: 40,442,713	N194D	probably damaging	Het
Ip6k1	G	A	9: 108,045,823	V385M	probably damaging	Het
Lig1	G	A	7: 13,288,685	R147Q	probably damaging	Het
Lrp1b	C	T	2: 40,647,153	V41I	probably damaging	Het
Mst1r	T	A	9: 107,917,225	V1201E	probably damaging	Het
Myof	T	C	19: 37,903,668		probably benign	Het
Nbas	G	T	12: 13,482,378		probably benign	Het
Ndst1	A	G	18: 60,707,647	I321T	possibly damaging	Het
Nek10	G	A	14: 14,850,983	G343R	probably damaging	Het
Olfr13	A	T	6: 43,174,300	T105S	probably benign	Het
Olfr1385	T	A	11: 49,494,823	C97S	probably damaging	Het
Olfr462	A	T	11: 87,889,296	I200N	probably damaging	Het
Pde4d	T	C	13: 109,117,061	S141P	probably benign	Het
Pigm	A	T	1: 172,376,814	Q39L	probably damaging	Het
Prl7a2	T	A	13: 27,662,767	I88F	probably benign	Het
Prss16	T	A	13: 22,008,686		probably benign	Het
Psmc4	G	A	7: 28,042,797		probably benign	Het
Ptger3	T	A	3: 157,567,728	C237*	probably null	Het
Recql	G	A	6: 142,372,875	T214M	probably damaging	Het
Rfx7	T	A	9: 72,619,575	V1349D	probably damaging	Het
Ros1	A	G	10: 52,087,945	S1740P	probably damaging	Het
Rrm2b	A	T	15: 37,946,809	S83T	probably benign	Het
Sall4	A	G	2: 168,756,474	Y149H	probably benign	Het
Smad1	A	G	8: 79,349,578		probably benign	Het
Snrnp70	T	C	7: 45,380,705		probably benign	Het
Spef2	C	A	15: 9,725,108		probably benign	Het
Sptlc1	T	C	13: 53,351,624	T253A	probably benign	Het
Zbbx	T	C	3: 75,052,477	Y595C	possibly damaging	Het
Zfp382	T	C	7: 30,133,689	V255A	probably benign	Het

Other mutations in Bmp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Bmp1	APN	14	70492461	missense	probably damaging	1.00
IGL02065:Bmp1	APN	14	70486220	missense	probably damaging	0.97
IGL02065:Bmp1	APN	14	70490107	missense	probably damaging	0.99
IGL02349:Bmp1	APN	14	70507549	missense	possibly damaging	0.61
IGL02486:Bmp1	APN	14	70504776	missense	possibly damaging	0.48
PIT4519001:Bmp1	UTSW	14	70490029	missense	possibly damaging	0.65
R0394:Bmp1	UTSW	14	70490034	missense	probably damaging	0.99
R1604:Bmp1	UTSW	14	70508004	missense	possibly damaging	0.66
R1732:Bmp1	UTSW	14	70486265	missense	possibly damaging	0.67
R1834:Bmp1	UTSW	14	70508831	missense	possibly damaging	0.73
R2008:Bmp1	UTSW	14	70492466	missense	probably damaging	1.00
R2197:Bmp1	UTSW	14	70486272	missense	possibly damaging	0.83
R3157:Bmp1	UTSW	14	70492107	missense	possibly damaging	0.63
R4397:Bmp1	UTSW	14	70490542	splice site	probably null
R4609:Bmp1	UTSW	14	70477966	missense	probably benign	0.00
R4613:Bmp1	UTSW	14	70508523	missense	probably damaging	1.00
R4675:Bmp1	UTSW	14	70492844	missense	probably damaging	0.99
R4796:Bmp1	UTSW	14	70492073	splice site	probably null
R4884:Bmp1	UTSW	14	70475215	missense	probably benign	0.01
R4905:Bmp1	UTSW	14	70491362	missense	probably benign	0.06
R5088:Bmp1	UTSW	14	70486219	missense	possibly damaging	0.84
R5225:Bmp1	UTSW	14	70480165	missense	probably damaging	0.97
R5271:Bmp1	UTSW	14	70508128	missense	probably benign	0.34
R5625:Bmp1	UTSW	14	70486166	missense	probably benign	0.19
R5653:Bmp1	UTSW	14	70490094	missense	probably benign	0.00
R6155:Bmp1	UTSW	14	70508007	missense	probably damaging	1.00
R6295:Bmp1	UTSW	14	70491383	missense	possibly damaging	0.88
R6618:Bmp1	UTSW	14	70491368	missense	probably damaging	1.00
R6649:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6653:Bmp1	UTSW	14	70490618	missense	probably damaging	1.00
R6951:Bmp1	UTSW	14	70508858	missense	probably benign	0.26
R6983:Bmp1	UTSW	14	70508207	missense	probably damaging	0.96
R7207:Bmp1	UTSW	14	70479560	missense	possibly damaging	0.56
R7500:Bmp1	UTSW	14	70490122	missense	probably benign	0.44
R7716:Bmp1	UTSW	14	70477922	nonsense	probably null
R7749:Bmp1	UTSW	14	70492844	missense	probably damaging	1.00
R7763:Bmp1	UTSW	14	70492084	missense	probably damaging	1.00
R7834:Bmp1	UTSW	14	70508565	missense	probably damaging	1.00
R8232:Bmp1	UTSW	14	70519889	missense	probably damaging	0.97
R8490:Bmp1	UTSW	14	70490133	missense	possibly damaging	0.94
R8827:Bmp1	UTSW	14	70490642	missense	probably damaging	1.00
R8945:Bmp1	UTSW	14	70490190	missense	probably damaging	1.00
R9178:Bmp1	UTSW	14	70490173	missense	possibly damaging	0.78
R9228:Bmp1	UTSW	14	70519898	missense	probably benign
R9621:Bmp1	UTSW	14	70477866	missense	probably benign	0.29
R9652:Bmp1	UTSW	14	70477920	missense	probably damaging	1.00
X0028:Bmp1	UTSW	14	70508537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGAGGTTGCTGCTCTCGCTG -3'
(R):5'- AAGCCTGCTGACCGCCATTATC -3'

Sequencing Primer
(F):5'- TAGTCGTAGGCACAACTGTCG -3'
(R):5'- TGACCGCCATTATCCTGTG -3'

Posted On

2014-02-18